
Androgen Pathway Reporter
Androgen signaling
Androgens, mainly testosterone and 5alpha-dihydrotestosterone (DHT) through their associations with Androgen receptor (AR, also known as NR3C4) will become the ctivated AR upon ligand binding undergoes conformational change to form a homodimer and interacts tightly with the Androgen Response Element (A-RE) which regulates gene expression.
Various regulators that regulate androgen induced apoptosis include BRCA1 and Smad3 and Akt, and much more.
Androgen pathway detection
- Reporting lentivirusses can monitor Androgen signaling pathway, the transcriptional activity of the androgen receptor.
- The reporting lentivirus has a luminescent report (Luciferase, Renilla Luc) or a fluorescent report (GFP, RFP) or a secreted SEAP report, under a minimal CMV promoter (mCMV) that embedded with optimized tandem repeats of Androgen Response Element (A-RE) sequence motif (5′- TGGAGGAACATATTGTATTTATT). The luciferase signal can be measured via Luciferase assay.
- The fluorescent reporter can be detected via its fluorescent signal.
- The SEAP secreted into cell culture supernatant, which allows to determine reporter activity without disturbing the cells, does not require the preparation of cell lysates and can be used for kinetic studies.
- When androgenic hormones, testosterone or dihydrotestosterone binds to its receptor (AR), it activated the receptor.
- The activated receptor then binds to A-RE which induce the downstream reporter’s expression as the result of activation for the minimal promoter. The reporter’s signal can be easily and rapidly readout via all types of assays (Reporter assay or by fluorescent microscope or FACS sorter).
- Androgen Pathway Report Lentiviral particles in hek 293 cells.
- Those reporting lentivirus also contains a constitutively expressed fluorescent selection marker or an antibiotic selection marker under the RSV promoter, which makes it easier to select the stably infected signal reporting cells (to generate pathway specific sensor cell lines), or provides internal reference for virus transduction efficiency.
- Product
- Qty in Cart
- Quantity
- Price
- Subtotal
-
AR-SEAP (RFP) Lentivirus in PBS | LVP1243-PBS
GenTarget
€709.00AR-SEAP (RFP) Lentivirus in PBS | LVP1243-PBS | GenTargetDescription:Concentrated lentivirus express SEAP reporter under the minimal promoter contains 4 tandem repeats of Androgen Response Element (ARE) . It contains the RFP fluorescent marker, provided...€709.00 -
AR-SEAP (RFP) Lentivirus | LVP1243
GenTarget
€552.00AR-SEAP (RFP) Lentivirus | LVP1243 | GenTargetDescription:Lentivirus express SEAP reporter under the minimal promoter contains 4 tandem repeats of Androgen Response Element (ARE) . It contains the RFP fluorescent marker, provided in DMEM medium with...€552.00 -
AR-SEAP (Puro) Lentivirus in PBS | LVP1240-PBS
GenTarget
€709.00AR-SEAP (Puro) Lentivirus in PBS | LVP1240-PBS | GenTargetDescription:Concentrated lentivirus express SEAP reporter under the minimal promoter contains 4 tandem repeats of Androgen Response Element (ARE) . It contains the puromycin, provided in PBS...€709.00 -
AR-SEAP (Puro) Lentivirus | LVP1240
GenTarget
€552.00AR-SEAP (Puro) Lentivirus | LVP1240 | GenTargetDescription:Lentivirus express SEAP reporter under the minimal promoter contains 4 tandem repeats of Androgen Response Element (ARE) . It contains the puromycin, provided in DMEM medium with 60ug/ml of...€552.00 -
AR-SEAP (Neo) Lentivirus in PBS | LVP1242-PBS
GenTarget
€709.00AR-SEAP (Neo) Lentivirus in PBS | LVP1242-PBS | GenTargetDescription:Concentrated lentivirus express SEAP reporter under the minimal promoter contains 4 tandem repeats of Androgen Response Element (ARE) . It contains the Neomycin, provided in PBS...€709.00 -
AR-SEAP (Neo) Lentivirus | LVP1242
GenTarget
€552.00AR-SEAP (Neo) Lentivirus | LVP1242 | GenTargetDescription:Lentivirus express SEAP reporter under the minimal promoter contains 4 tandem repeats of Androgen Response Element (ARE) . It contains the Neomycin, provided in DMEM medium with 60ug/ml of...€552.00 -
AR-SEAP (Bsd) Lentivirus in PBS | LVP1241-PBS
GenTarget
€709.00AR-SEAP (Bsd) Lentivirus in PBS | LVP1241-PBS | GenTargetDescription:Concentrated lentivirus express SEAP reporter under the minimal promoter contains 4 tandem repeats of Androgen Response Element (ARE) . It contains the Blasticidin, provided in PBS...€709.00 -
AR-SEAP (Bsd) Lentivirus | LVP1241
GenTarget
€552.00AR-SEAP (Bsd) Lentivirus | LVP1241 | GenTargetDescription:Lentivirus express SEAP reporter under the minimal promoter contains 4 tandem repeats of Androgen Response Element (ARE) . It contains the Blasticidin, provided in DMEM medium with 60ug/ml of...€552.00 -
AR-Rluc (RFP) Lentivirus in PBS | LVP915-R-PBS
GenTarget
€709.00AR-Rluc (RFP) Lentivirus in PBS | LVP915-R-PBS | GenTargetDescription:Pre-made lentivirus express Renilla luciferase reporter under the minimal promoter contains 4 tandem repeats of Androgen Response Element (ARE) . This lentivirus also contain the RFP...€709.00 -
AR-Rluc (RFP) Lentivirus | LVP915-R
GenTarget
€552.00AR-Rluc (RFP) Lentivirus | LVP915-R | GenTargetDescription:Pre-made lentivirus express Renilla luciferase reporter under the minimal promoter contains 4 tandem repeats of Androgen Response Element (ARE) . This lentivirus also contain the RFP selection...€552.00 -
AR-Rluc (Puro) Lentivirus in PBS | LVP915-P-PBS
GenTarget
€709.00AR-Rluc (Puro) Lentivirus in PBS | LVP915-P-PBS | GenTargetDescription:Pre-made lentivirus express Renilla luciferase reporter under the minimal promoter contains 4 tandem repeats of Androgen Response Element (ARE) . This lentivirus also contain the...€709.00 -
AR-Rluc (Puro) Lentivirus | LVP915-P
GenTarget
€552.00AR-Rluc (Puro) Lentivirus | LVP915-P | GenTargetDescription:Pre-made lentivirus express Renilla luciferase reporter under the minimal promoter contains 4 tandem repeats of Androgen Response Element (ARE) . This lentivirus also contain the puromycin...€552.00 -
AR-Rluc (Neo) Lentivirus in PBS | LVP915-N-PBS
GenTarget
€709.00AR-Rluc (Neo) Lentivirus in PBS | LVP915-N-PBS | GenTargetDescription:Pre-made lentivirus express Renilla luciferase reporter under the minimal promoter contains 4 tandem repeats of Androgen Response Element (ARE) . This lentivirus also contain the...€709.00 -
AR-Rluc (Neo) Lentivirus | LVP915-N
GenTarget
€552.00AR-Rluc (Neo) Lentivirus | LVP915-N | GenTargetDescription:Pre-made lentivirus express Renilla luciferase reporter under the minimal promoter contains 4 tandem repeats of Androgen Response Element (ARE) . This lentivirus also contain the Neomycin...€552.00 -
AR-Rluc (GFP) Lentivirus in PBS | LVP915-G-PBS
GenTarget
€709.00AR-Rluc (GFP) Lentivirus in PBS | LVP915-G-PBS | GenTargetDescription:Pre-made lentivirus express Renilla luciferase reporter under the minimal promoter contains 4 tandem repeats of Androgen Response Element (ARE) . This lentivirus also contain the GFP...€709.00 -
AR-Rluc (GFP) Lentivirus | LVP915-G
GenTarget
€552.00AR-Rluc (GFP) Lentivirus | LVP915-G | GenTargetDescription:Pre-made lentivirus express Renilla luciferase reporter under the minimal promoter contains 4 tandem repeats of Androgen Response Element (ARE) . This lentivirus also contain the GFP selection...€552.00 -
AR-Rluc (Bsd) Lentivirus in PBS | LVP915-B-PBS
GenTarget
€709.00AR-Rluc (Bsd) Lentivirus in PBS | LVP915-B-PBS | GenTargetDescription:Pre-made lentivirus express Renilla luciferase reporter underthe minimal promoter contains 4 tandem repeats of Androgen Response Element (ARE) . This lentivirus also contain the...€709.00 -
AR-Rluc (Bsd) Lentivirus | LVP915-B
GenTarget
€552.00AR-Rluc (Bsd) Lentivirus | LVP915-B | GenTargetDescription:Pre-made lentivirus express Renilla luciferase reporter underthe minimal promoter contains 4 tandem repeats of Androgen Response Element (ARE) . This lentivirus also contain the Blasticidin...€552.00 -
AR-RFP (Puro) Lentivirus in PBS | LVP913-P-PBS
GenTarget
€709.00AR-RFP (Puro) Lentivirus in PBS | LVP913-P-PBS | GenTargetDescription:Pre-made Lentivirus express RFP reporter under the minimal promoter contains 4 tandem repeats of Androgen Response Element (ARE) . This Lentivirus also contain the puromycin selection...€709.00 -
AR-RFP (Puro) Lentivirus | LVP913-P
GenTarget
€552.00AR-RFP (Puro) Lentivirus | LVP913-P | GenTargetDescription:Pre-made Lentivirus express RFP reporter under the minimal promoter contains 4 tandem repeats of Androgen Response Element (ARE) . This Lentivirus also contain the puromycin selection marker...€552.00 -
AR-RFP (Neo) Lentivirus in PBS | LVP913-N-PBS
GenTarget
€709.00AR-RFP (Neo) Lentivirus in PBS | LVP913-N-PBS | GenTargetDescription:Pre-made lentivirus express RFP reporter under the minimal promoter contains 4 tandem repeats of Androgen Response Element (ARE) . This lentivirus also contain the Neomycin selection...€709.00 -
AR-RFP (Neo) Lentivirus | LVP913-N
GenTarget
€552.00AR-RFP (Neo) Lentivirus | LVP913-N | GenTargetDescription:Pre-made lentivirus express RFP reporter under the minimal promoter contains 4 tandem repeats of Androgen Response Element (ARE) . This lentivirus also contain the Neomycin selection marker under...€552.00 -
AR-RFP (GFP) Lentivirus in PBS | LVP913-G-PBS
GenTarget
€709.00AR-RFP (GFP) Lentivirus in PBS | LVP913-G-PBS | GenTargetDescription:Pre-made lentivirus express RFP reporter under the minimal promoter contains 4 tandem repeats of Androgen Response Element (ARE) . This lentivirus also contain the GFP selection marker...€709.00 -
AR-RFP (GFP) Lentivirus | LVP913-G
GenTarget
€552.00AR-RFP (GFP) Lentivirus | LVP913-G | GenTargetDescription:Pre-made lentivirus express RFP reporter under the minimal promoter contains 4 tandem repeats of Androgen Response Element (ARE) . This lentivirus also contain the GFP selection marker under the...€552.00 -
AR-RFP (Bsd) Lentivirus in PBS | LVP913-B-PBS
GenTarget
€709.00AR-RFP (Bsd) Lentivirus in PBS | LVP913-B-PBS | GenTargetDescription:Pre-made lentivirus express RFP reporter under the minimal promoter contains 4 tandem repeats of Androgen Response Element (ARE) . This lentivirus also contain the Blasticidin selection...€709.00 -
AR-RFP (Bsd) Lentivirus | LVP913-B
GenTarget
€552.00AR-RFP (Bsd) Lentivirus | LVP913-B | GenTargetDescription:Pre-made lentivirus express RFP reporter under the minimal promoter contains 4 tandem repeats of Androgen Response Element (ARE) . This lentivirus also contain the Blasticidin selection marker...€552.00 -
AR-Luc (RFP) Lentivirus in PBS | LVP914-R-PBS
GenTarget
€709.00AR-Luc (RFP) Lentivirus in PBS | LVP914-R-PBS | GenTargetDescription:Pre-made lentivirus express Firefly luciferase reporter under the minimal promoter contains 4 tandem repeats of Androgen Response Element (ARE) . This lentivirus also contain the RFP...€709.00 -
AR-Luc (RFP) Lentivirus | LVP914-R
GenTarget
€552.00AR-Luc (RFP) Lentivirus | LVP914-R | GenTargetDescription:Pre-made lentivirus express Firefly luciferase reporter under the minimal promoter contains 4 tandem repeats of Androgen Response Element (ARE) . This lentivirus also contain the RFP selection...€552.00 -
AR-Luc (Puro) Lentivirus in PBS | LVP914-P-PBS
GenTarget
€709.00AR-Luc (Puro) Lentivirus in PBS | LVP914-P-PBS | GenTargetDescription:Pre-made lentivirus express Firefly luciferase reporter under the minimal promoter contains 4 tandem repeats of Androgen Response Element (ARE) . This lentivirus also contain the...€709.00 -
AR-Luc (Puro) Lentivirus | LVP914-P
GenTarget
€552.00AR-Luc (Puro) Lentivirus | LVP914-P | GenTargetDescription:Pre-made lentivirus express Firefly luciferase reporter under the minimal promoter contains 4 tandem repeats of Androgen Response Element (ARE) . This lentivirus also contain the puromycin...€552.00 -
AR-Luc (Neo) Lentivirus in PBS | LVP914-N-PBS
GenTarget
€709.00AR-Luc (Neo) Lentivirus in PBS | LVP914-N-PBS | GenTargetDescription:Pre-made lentivirus express Firefly luciferase reporter under the minimal promoter contains 4 tandem repeats of Androgen Response Element (ARE) . This lentivirus also contain the...€709.00 -
AR-Luc (Neo) Lentivirus | LVP914-N
GenTarget
€552.00AR-Luc (Neo) Lentivirus | LVP914-N | GenTargetDescription:Pre-made lentivirus express Firefly luciferase reporter under the minimal promoter contains 4 tandem repeats of Androgen Response Element (ARE) . This lentivirus also contain the Neomycin...€552.00 -
AR-Luc (GFP) Lentivirus in PBS | LVP914-G-PBS
GenTarget
€709.00AR-Luc (GFP) Lentivirus in PBS | LVP914-G-PBS | GenTargetDescription:Pre-made lentivirus express Firefly luciferase reporter under the minimal promoter contains 4 tandem repeats of Androgen Response Element (ARE) . This lentivirus also contain the GFP...€709.00 -
AR-Luc (GFP) Lentivirus | LVP914-G
GenTarget
€552.00AR-Luc (GFP) Lentivirus | LVP914-G | GenTargetDescription:Pre-made lentivirus express Firefly luciferase reporter under the minimal promoter contains 4 tandem repeats of Androgen Response Element (ARE) . This lentivirus also contain the GFP selection...€552.00 -
AR-Luc (Bsd) Lentivirus in PBS | LVP914-B-PBS
GenTarget
€709.00AR-Luc (Bsd) Lentivirus in PBS | LVP914-B-PBS | GenTargetDescription:Pre-made lentivirus express Firefly luciferase reporter under the minimal promoter contains 4 tandem repeats of Androgen Response Element (ARE) .. This lentivirus also contain the...€709.00 -
AR-Luc (Bsd) Lentivirus | LVP914-B
GenTarget
€552.00AR-Luc (Bsd) Lentivirus | LVP914-B | GenTargetDescription:Pre-made lentivirus express Firefly luciferase reporter under the minimal promoter contains 4 tandem repeats of Androgen Response Element (ARE) .. This lentivirus also contain the Blasticidin...€552.00 -
AR-GFP (RFP) Lentivirus in PBS | LVP912-R-PBS
GenTarget
€709.00AR-GFP (RFP) Lentivirus in PBS | LVP912-R-PBS | GenTargetDescription:Pre-made lentivirus express GFP reporter under the minimal promoter contains 4 tandem repeats of Androgen Response Element (ARE) . This lentivirus also contain the RFP selection marker...€709.00 -
AR-GFP (RFP) Lentivirus | LVP912-R
GenTarget
€552.00AR-GFP (RFP) Lentivirus | LVP912-R | GenTargetDescription:Pre-made lentivirus express GFP reporter under the minimal promoter contains 4 tandem repeats of Androgen Response Element (ARE) . This lentivirus also contain the RFP selection marker under the...€552.00 -
AR-GFP (Puro) Lentivirus in PBS | LVP912-P-PBS
GenTarget
€709.00AR-GFP (Puro) Lentivirus in PBS | LVP912-P-PBS | GenTargetDescription:Pre-made Lentivirus express GFP reporter under the minimal promoter contains 4 tandem repeats of Androgen Response Element (ARE) . This Lentivirus also contain the puromycin selection...€709.00 -
AR-GFP (Puro) Lentivirus | LVP912-P
GenTarget
€552.00AR-GFP (Puro) Lentivirus | LVP912-P | GenTargetDescription:Pre-made Lentivirus express GFP reporter under the minimal promoter contains 4 tandem repeats of Androgen Response Element (ARE) . This Lentivirus also contain the puromycin selection marker...€552.00 -
AR-GFP (Neo) Lentivirus in PBS | LVP912-N-PBS
GenTarget
€709.00AR-GFP (Neo) Lentivirus in PBS | LVP912-N-PBS | GenTargetDescription:Pre-made lentivirus express GFP reporter under the minimal promoter contains 4 tandem repeats of Androgen Response Element (ARE) . This lentivirus also contain the Neomycin selection...€709.00 -
AR-GFP (Neo) Lentivirus | LVP912-N
GenTarget
€552.00AR-GFP (Neo) Lentivirus | LVP912-N | GenTargetDescription:Pre-made lentivirus express GFP reporter under the minimal promoter contains 4 tandem repeats of Androgen Response Element (ARE) . This lentivirus also contain the Neomycin selection marker under...€552.00 -
AR-GFP (Bsd) Lentivirusin PBS | LVP912-B-PBS
GenTarget
€709.00AR-GFP (Bsd) Lentivirusin PBS | LVP912-B-PBS | GenTargetDescription:Pre-made lentivirus express GFP reporter under the minimal promoter contains 4 tandem repeats of Androgen Response Element (ARE) . This lentivirus also contain the Blasticidin selection...€709.00 -
AR-GFP (Bsd) Lentivirus | LVP912-B
GenTarget
€552.00AR-GFP (Bsd) Lentivirus | LVP912-B | GenTargetDescription:Pre-made lentivirus express GFP reporter under the minimal promoter contains 4 tandem repeats of Androgen Response Element (ARE) . This lentivirus also contain the Blasticidin selection marker...€552.00