Cusabio
KRAS Clone BC010502
- SKU:
- CSB-CL012493HU2
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRAS
- Gene ID:
- 3845
- Accession #:
- BC010502
- Vector:
- pENTR223.1 or pUC
Description
KRAS Clone BC010502 | Cusabio
Gene Name: KRAS
Gene ID: 3845
Accession Number: BC010502
Plasmid: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGCAGTGGCGCCATCTCAGCTCACTGCAACCTCCATCTCCCAGGTTCAAGCGATTCTCGTGCCTCGGCCTCCTGAGTAGCTGGGATTACAGGCGTGTGCCACTACACTCAACTAATTTTTGTATTTTTAGGAGAGACGGGGTTTCACCCTGTTGGCCAGGCTGGTCTCGAACTCCTGACCTCAAGTGA
Length: 189
Related Products
KRAS Clone BC013572 pENTR223.1
Cusabio
€214.00
KRAS Clone BC013572 pENTR223.1 | CusabioGene Name: KRASGene ID: 3845Accession Number: BC013572Plasmid: pENTR223.1Sequence:...
pDsRed1-Kras-m Plasmid | PVT17612
Nova Lifetech
€258.00
Product Name: pDsRed1-Kras-m Plasmid
Cat#: PVT17612Supplier: Nova Lifetech / Life Science MarketAvailable with 5 to 7 Working days.
pDsRed2-Kras-m Plasmid | PVT17383
Nova Lifetech
€258.00
Product Name: pDsRed2-Kras-m Plasmid
Cat#: PVT17383Supplier: Nova Lifetech / Life Science MarketAvailable with 5 to 7 Working days.
pCMV-SPORT6-KRAS Plasmid | PVT13430
Nova Lifetech
€391.00
Product Name: pCMV-SPORT6-KRAS Plasmid
Cat#: PVT13430Supplier: Nova Lifetech / Life Science MarketAvailable with 5 to 7 Working days.
pET28a-KRAS Plasmid | PVTB00578-1b
Nova Lifetech
€356.00
Product Name: pET28a-KRAS PlasmidCat#: PVTB00578-1bSupplier: Nova Lifetech / Life Science MarketAvailable with 5 to 7 Working days.
pDsRed1-Kras-m-5 Plasmid | PVT17507
Nova Lifetech
€258.00
Product Name: pDsRed1-Kras-m-5 Plasmid
Cat#: PVT17507Supplier: Nova Lifetech / Life Science MarketAvailable with 5 to 7 Working days.
h KRAS inducible lentiviral particles | LVP762
GenTarget
€450.00
h KRAS inducible lentiviral particles | LVP762 | GenTargetDescription:Pre-made over-expression lentivirus for expressing human target: h KRAS (Kirsten rat sarcoma viral oncogene homolog),...
h KRAS (G12D) Expression Lentivirus | LVP1166
GenTarget
€450.00
h KRAS (G12D) Expression Lentivirus | LVP1166 | GenTargetDescription:Pre-made over-expression lentivirus for a mutant (G12D) of human target: KRAS containing a RFP-Blasticidin dual selection marker...
pX459 V2.0-KRAS-m-sgRNA1 Plasmid | PVT14495
Nova Lifetech
€703.00
Product Name: pX459 V2.0-KRAS-m-sgRNA1 Plasmid
Cat#: PVT14495Supplier: Nova Lifetech / Life Science MarketAvailable with 5 to 7 Working days.