null

ABCF2 Clone BC001661

(No reviews yet) Write a Review
SKU:
CSB-CL871400HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ABCF2
Gene ID:
10061
Accession #:
BC001661
Vector:
pENTR223.1 or pUC
€347.00
Frequently bought together:

Description

ABCF2 Clone BC001661 | Cusabio

Gene Name: ABCF2

Gene ID: 10061

Accession Number: BC001661

Plasmid: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGCCCTCCGACCTGGCCAAGAAGAAGGCAGCCAAAAAGAAGGAGGCTGCCAAAGCTCGACAGCGGCCCAGAAAAGGACATGAAGAAAATGGAGATGTTGTCACAGAACCACAGGTGGCAGAGAAGAATGAGGCCAATGGCAGAGAGACCACAGAAGTAGATTTGCTGACCAAGGAGCTAGAGGACTTTGAGATGAAGAAAGCTGCTGCTCGAGCTGTCACTGGCGTCCTGGCCTCTCACCCCAACAGTACTGATGTTCACATCATCAACCTCTCACTCACCTTTCATGGTCAAGAGCTGCTCAGTGACACCAAACTGGAATTAAACTCAGGCCGTCGTTATGGCCTCATTGGTTTAAATGGAATTGGAAAGTCCATGCTGCTCTCTGCTATTGGGAAGCGTGAAGTGCCCATCCCTGAGCACATCGACATCTACCATCTGACTCGAGAGATGCCCCCTAGTGACAAGACACCCTTGCATTGTGTGATGGAAGTCGACACAGAGCGGGCCATGCTGGAGAAAGAGGCAGAGCGGCTGGCTCATGAGGATGCGGAGTGTGAGAAGCTCATGGAGCTCTACGAGCGCCTGGAGGAGCTGGATGCCGACAAGGCAGAGATGAGGGCCTCGCGGATCTTGCATGGACTGGGTTTCACACCTGCCATGCAGCGCAAGAAGCTAAAAGACTTCAGTGGGGGCTGGAGGATGAGGGTTGCCCTTGCCAGAGCCCTCTTTATTCGGCCCTTCATGCTGCTCCTGGATGAGCCTACCAACCACCTGGACCTAGATGCTTGCGTGTGGTTGGAAGAAGAACTAAAAACTTTTAAGCGCATCTTGGTCCTCGTCTCCCATTCCCAGGATTTTCTGAATGGTGTCTGTACCAATATCATTCACATGCACAACAAGAAACTGAAGTATTATACGGGTAATTATGATCAGTATGTGAAGACGCGGCTAGAGCTGGAGGAGAACCAGATGAAGAGGTTTCACTGGGAGCAAGATCAGATTGCACACATGAAGAACTACATTGCGAGGTTTGGTCATGGCAGTGCCAAGCTGGCCCGGCAGGCCCAGAGCAAGGAGAAGACGCTACAGAAAATGATGGCATCAGGACTGACAGAGAGGGTCGTGAGCGATAAGACACTGTCATTTTATTTCCCACCATGTGGCAAGATCCCTCCACCTGTCATTATGGTGCAAAATGTGAGCTTCAAGTATACAAAAGATGGGCCTTGCATCTACAATAATCTAGAATTTGGAATTGACCTTGACACACGAGTGGCTCTGGTAGGGCCCAATGGAGCAGGGAAGTCAACTCTTCTGAAGCTGCTAACTGGAGAGCTACTACCCACAGATGGCATGATCCGAAAACACTCTCATGTCAAGATAGGGCGTTACCATCAGCATTTACAAGAGCAGCTGGACTTAGATCTCTCACCTTTGGAGTACATGATGAAGTGCTACCCAGAGATCAAGGAGAAGGAAGAAATGAGGAAGATCATTGGGCGATACGGTCTCACTGGGAAACAACAGGTGAGCCCAATCCGGAACTTGTCAGACGGGCAGAAGTGCCGAGTGTGTCTGGCCTGGCTGGCCTGGCAGAACCCCCACATGCTCTTCCTGGATGAACCCACCAATCACCTGGATATCGAGACCATCGACGCCCTGGCAGATGCCATCAATGAGTTTGAGGGTGGTATGATGCTGGTCAGCCATGACTTCAGACTCATTCAGCAGGTTGCACAGGAAATTTGGGTCTGTGAGAAGCAGACAATCACCAAGTGGCCTGGAGACATCCTGGCTTACAAGGAGCACCTCAAGTCCAAGCTGGTGGATGAGGAGCCCCAGCTCACCAAGAGGACCCACAACGTGTGA

Length: 1872

View AllClose