null

ABCG8 Clone BC113657 pENTR223.1

(No reviews yet) Write a Review
SKU:
CSB-CL875651HU
Availability:
3 to 5 Working Days
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ABCG8
Gene ID:
64241
Accession #:
BC113657
Vector:
pENTR223.1
€214.00
Frequently bought together:

Description

ABCG8 Clone BC113657 pENTR223.1 | Cusabio

Gene Name: ABCG8

Gene ID: 64241

Accession Number: BC113657

Plasmid: pENTR223.1

Sequence: ATGGCCGGGAAGGCGGCAGAGGAGAGAGGGCTGCCGAAAGGGGCCACTCCCCAGCATACCTCGGGCCTCCAGGATAGATTGTTCTCCTCTGAAAGTGACAACAGCCTGTACTTCACCTACAGTGGCCAGCCCAACACCCTGGAGGTCAGAGACCTCAACTACCAGGTGGACCTGGCCTCTCAGGTCCCTTGGTTTGAGCAGCTGGCTCAGTTCAAGATGCCCTGGACATCTCCCAGCTGCCAGAATTCTTGTGAGCTGGGCATCCAGAACCTAAGCTTCAAAGTGAGAAGTGGGCAGATGCTGGCCATCATAGGGAGCTCAGGTTGTGGGAGAGCCTCCTTGCTAGATGTGATCACTGGCCGAGGTCACGGCGGCAAGATCAAGTCAGGCCAGATCTGGATCAATGGGCAGCCCAGCTCGCCTCAGCTGGTGAGGAAGTGTGTGGCCCACGTGCGCCAGCACAACCAGCTGCTCCCCAACTTGACTGTGCGAGAGACCTTGGCCTTCATTGCCCAGATGCGGCTGCCCAGAACCTTCTCCCAGGCCCAGCGTGACAAAAGGGTGGAGGACGTGATCGCGGAGCTGCGGCTTAGGCAGTGCGCTGACACCCGCGTGGGCAACATGTACGTGCGGGGGTTGTCGGGGGGTGAGCGCAGGAGAGTCAGCATTGGGGTGCAGCTCCTGTGGAACCCAGGAATCCTTATTCTCGACGAACCCACCTCTGGGCTCGACAGCTTCACAGCCCACAACCTGGTGAAGACCTTGTCCAGGCTGGCCAAAGGCAACCGGCTGGTGCTCATCTCCCTCCACCAGCCTCGCTCTGACATCTTCAGGCTGTTTGATCTGGTCCTCCTGATGACGTCTGGCACCCCCATCTACTTAGGGGCGGCCCAGCACATGGTCCAGTATTTCACAGCCATCGGCTACCCCTGTCCTCGCTACAGCAATCCTGCTGACTTCTATGTGGACCTGACCAGCATTGACAGGCGCAGCAGAGAGCAGGAATTGGCCACCAGGGAGAAGGCTCAGTCACTCGCAGCCCTGTTTCTAGAAAAAGTGCGTGACTTAGATGACTTTCTATGGAAAGCAGAGACGAAGGATCTTGACGAGGACACCTGTGTGGAAAGCAGCGTGACCCCACTAGACACCAACTGCCTCCCGAGTCCTACGAAGATGCCTGGGGCGGTGCAGCAGTTTACGACGCTGATCCGTCGTCAGATTTCCAACGACTTCCGAGACCTGCCCACCCTCCTCATCCATGGGGCGGAGGCCTGTCTGATGTCAATGACCATCGGCTTCCTCTATTTTGGCCATGGGAGCATCCAGCTCTCCTTCATGGATACAGCCGCCCTCTTGTTCATGATCGGTGCTCTCATCCCTTTCAACGTCATTCTGGATGTCATCTCCAAATGTTACTCAGAGAGGGCAATGCTTTACTATGAACTGGAAGACGGGCTGTACACCACTGGTCCATATTTCTTTGCCAAGATCCTCGGGGAGCTTCCGGAGCACTGTGCCTACATCATCATCTACGGGATGCCCACCTACTGGCTGGCCAACCTGAGGCCAGGCCTCCAGCCCTTCCTGCTGCACTTCCTGCTGGTGTGGCTGGTGGTCTTCTGTTGCAGGATTATGGCCCTGGCCGCCGCGGCCCTGCTCCCCACCTTCCACATGGCCTCCTTCTTCAGCAATGCCCTCTACAACTCCTTCTACCTCGCCGGGGGCTTCATGATAAACTTGAGCAGCCTGTGGACAGTGCCCGCGTGGATTTCCAAAGTGTCCTTCCTGCGGTGGTGTTTTGAAGGGCTGATGAAGATTCAGTTCAGCAGAAGAACTTATAAAATGCCTCTCGGGAACCTCACCATCGCGGTCTCAGGAGATAAAATCCTCAGTGCCATGGAGCTGGACTCGTACCCTCTCTACGCCATCTACCTCATCGTCATTGGCCTCAGCGGTGGCTTCATGGTCCTGTACTACGTGTCCTTAAGGTTCATCAAACAGAAACCAAGTCAAGACTGGTGA

Length: 2022

View AllClose