null

ABHD10 Clone BC014516

(No reviews yet) Write a Review
SKU:
CSB-CL865140HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ABHD10
Gene ID:
55347
Accession #:
BC014516
Vector:
pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

ABHD10 Clone BC014516 | Cusabio

Gene Name: ABHD10

Gene ID: 55347

Accession Number: BC014516

Plasmid: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCGGTTGCGCGCTTGGCAGCTGTGGCGGCCTGGGTACCTTGTCGGAGCTGGGGCTGGGCAGCCGTCCCCTTCGGTCCCCACCGTGGCCTCAGCGTGCTGCTTGCACGGATACCTCAGCGGGCGCCACGGTGGCTCCCAGCTTGTAGACAAAAGACGTCACTCTCATTCCTTAATCGACCAGACCTTCCAAACCTGGCTTATAAGAAGCTAAAAGGCAAAAGTCCAGGAATTATCTTCATCCCTGGCTATCTTTCTTATATGAATGGTACAAAAGCGTTGGCGATTGAGGAGTTTTGCAAATCTCTAGGTCACGCCTGCATAAGGTTTGATTACTCAGGAGTTGGAAGTTCAGATGGTAACTCAGAGGAAAGCACACTGGGGAAATGGAGAAAAGATGTTCTTTCTATAATTGATGACTTAGCTGATGGGCCACAGATTCTTGTTGGATCTAGCCTTGGAGGGTGGCTTATGCTTCATGCTGCAATTGCACGACCAGAGAAGGTCGTGGCTCTTATTGGTGTAGCTACAGCTGCAGATACCTTAGTGACAAAGTTTAATCAGCTTCCTGTTGAGCTAAAAAAGGAAGTAGAGATGAAAGGTGTGTGGAGCATGCCATCAAAATACTCTGAAGAAGGAGTTTATAACGTTCAGTACAGTTTCATTAAAGAAGCTGAACATCACTGCTTGTTACATAGCCCAATTCCTGTGAACTGCCCCATAAGATTGCTCCATGGCATGAAGGATGACATTGTACCTTGGCATACATCAATGCAGGTTGCCGATCGAGTACTCAGCACAGATGTGGATGTCATCCTCCGAAAACACAGTGATCACCGAATGAGGGAAAAAGCAGACATTCAACTTCTTGTTTACACTATTGATGACTTAATTGATAAGCTCTCAACTATAGTTAACTAG

Length: 921

View AllClose