Cusabio

AKAP9 Clone BC015533 pENTR223.1

(No reviews yet) Write a Review
SKU:
CSB-CL857882HU
Availability:
3 to 5 Working Days
Size:
10 μg plasmid + 200μl Glycerol
Gene:
AKAP9
Gene ID:
10142
Accession #:
BC015533
Vector:
pENTR223.1
$256.80

Description

AKAP9 Clone BC015533 pENTR223.1 | Cusabio

Gene Name: AKAP9

Gene ID: 10142

Accession Number: BC015533

Plasmid: pENTR223.1

Sequence: ATGGAGGACGAGGAGAGACAGAAGAAGCTGGAGGCCGGCAAAGCCAAGCTTGCCCAGTTTCGACAAAGAAAAGCTCAGTCGGATGGGCAGAGTCCTTCCAAGAAGCAGAAAAAAAAGAGAAAAACGTCAAGCAGTAAACATGATGTGTCAGCACACCATGATTTGAATATTGATCAATCACAGTGTAATGAAATGTACATAAATAGTTCTCAGAGAGTAGAATCAACTGTGATTCCTGAATCTACAATAATGAGAACTCTACATAGTGGAGAAATAACCAGTCATGAGCAGGGCTTCTCTGTGGAACTGGAAAGTGAAATTTCAACCACAGCAGATGACTGCAGTTCAGAGGTAAATGGTTGCAGTTTTGTGATGAGAACAGGAAAGCCTACAAATTTATTAAGGGAAGAAGAATTTGGTGTTGATGATTCTTATTCTGAACAAGGAGCACAAGACAGTCCGACTCATCTAGAGATGATGGAAAGTGAGTTGGCTGGGAAGCAGCATGAGATTGAAGAGCTAAACAGAGAGCTGGAAGAAATGAGGGTTACCTATGGGACTGAAGGACTGCAGCAGTTACAAGAATTTGAAGCTGCCATTAAACAAAGAGATGGCATTATAACCCAGCTCACTGCTAATTTACAACAAGCAAGAAGAGAAAAGGATGAGACAATGAGAGAATTTTTAGAGTTGACAGAACAGAGTCAAAAATTACAGATTCAATTTCAGCAATTACAGGCTAGTGAAACTCTGAGAAACAGCACTCATAGTAGCACAGCTGCAGACTTACTACAAGCCAAACAACAGATCCTCACTCATCAACAGCAGCTTGAAGAACAAGACCACTTATTAGAAGATTATCAGAAAAAGAAAGAAGACTTCACAATGCAAATTAGTTTCTTGCAAGAGAAAATTAAAGTATATGAAATGGTATGTTTATTTTAA

Length: 945

View AllClose