null

C2orf56 Clone BC004548

(No reviews yet) Write a Review
SKU:
CSB-CL765978HU2
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
C2orf56
Gene ID:
55471
Accession #:
BC004548
Vector:
pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

C2orf56 Clone BC004548 | Cusabio

Gene Name: C2orf56

Gene ID: 55471

Accession Number: BC004548

Plasmid: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGAGTGTACTGCTGAGGTCAGGTTTGGGGCCGTTGTGTGCCGTGGCGCGCGCAGCCATTCCTTTTATTTGGAGAGGGAAATACTTCAGCTCCGGGAATGAGCCTGCAGAAAACCCGGTGACGCCGATGCTGCGGCATCTTATGTACAAAATAAAGTCTACTGGTCCCATCACTGTGGCCGAGTACATGAAGGAGGTGTTGACTAATCCAGCCAAGGGTTATTATGTGTACCGTGACATGCTAGGCGAAAAAGGAGATTTCATTACTTCACCTGAAATAAGTCAAATCTTTGGGGAGCTACTAGGTATATGGTTCATTAGTGAATGGATGGCCACTGGAAAAAGCACAGCTTTCCAGCTGGTGGAACTGGGCCCAGGTAGGGGAACCCTCGTGGGAGATATTTTGAGGGTGTTCACTCAACTTGGATCTGTGCTGAAAAATTGTGACATTTCAGTACATCTGGTAGAGGTAAGCCAAAAATTAAGTGAGATTCAAGCATTGACACTGACTAAAGAGAAGGTCCCGTTAGAGCGAAATGCTGGATCCCCAGTGTATATGAAAGGTGTCACTAAGTCTGGGATTCCAATTTCCTGGTACCGAGATCTGCACGATGTTCCAAAAGGGTACAGCTTTTATCTTGCACATGAATTTTTTGATGTTCTTCCTGTGCATAAATTTCAGAAAACACCACAGGGATGGCGAGAAGTATTTGTTGACATTGATCCACAGGTTTCTGATAAACTGAGGTTTGTTTTGGCACCTTCTGCCACCCCAGCAGAAGCCTTCATACAACATGACGAAACAAGGGATCATGTTGAAGTGTGTCCTGATGCTGGTGTTATCATCGAGGAACTTTCTCAACGCATTGCATTAACTGGAGGTGCTGCACTGGTTGCTGATTATGGTCATGATGGAACAAAGACAGATACCTTCAGAGGGTTTTGCGACCACAAGCTTCATGATGTCTTAATTGCCCCAGGAACAGCAGATCTAACAGCTGATGTGGACTTCAGTTATTTGCGAAGAATGGCACAGGGAAAAGTAGCCTCTCTGGGCCCAATAAAACAACACACATTTTTAAAAAATATGGGTATTGATGTCCGGCTGAAGGTTCTTTTAGATAAATCAAATGAGCCATCAGTGAGGCAGCAGTTACTTCAAGGATATGATATGTTAATGAATCCAAAGAAGATGGGAGAGAGATTTAACTTTTTTGCCTTGCTACCTCATCAGAGACTTCAAGGTGGAAGATATCAGAGGAATGCACGTCAGTCAAAACCCTTTGCATCCGTTGTAGCTGGGTTTAGTGAACTTGCTTGGCAGTGA

Length: 1326

View AllClose