CAT Clone BC110398

(No reviews yet) Write a Review
SKU:
CSB-CL004563HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
CAT
Gene ID:
847
Accession #:
BC110398
Vector:
pENTR223.1 or pUC
€347.00
Frequently bought together:

Description

CAT Clone BC110398 | Cusabio

Gene Name: CAT

Gene ID: 847

Accession Number: BC110398

Plasmid: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCTGACAGCCGGGATCCCGCCAGCGACCAGATGCAGCACTGGAAGGAGCAGCGGGCCGCGCAGAAAGCTGATGTCCTGACCACTGGAGCTGGTAACCCAGTAGGAGACAAACTTAATGTTATTACAGTAGGGCCCCGTGGGCCCCTTCTTGTTCAGGATGTGGTTTTCACTGATGAAATGGCTCATTTTGACCGAGAGAGAATTCCTGAGAGAGTTGTGCATGCTAAAGGAGCAGGGGCCTTTGGCTACTTTGAGGTCACACATGACATTACCAAATACTCCAAGGCAAAGGTATTTGAGCATATTGGAAAGAAGACTCCCATCGCAGTTCGGTTCTCCACTGTTGCTGGAGAATCGGGTTCAGCTGACACAGTTCGGGACCCTCGTGGGTTTGCAGTGAAATTTTACACAGAAGATGGTAACTGGGATCTCGTTGGAAATAACACCCCCATTTTCTTCATCAGGGATCCCATATTGTTTCCATCTTTTATCCACAGCCAAAAGAGAAATCCTCAGACACATCTGAAGGATCCGGACATGGTCTGGGACTTCTGGAGCCTACGTCCTGAGTCTCTGCATCAGGTTTCTTTCTTGTTCAGTGATCGGGGGATTCCAGATGGACATCGCCACATGAATGGATATGGATCACATACTTTCAAGCTGGTTAATGCAAATGGGGAGGCAGTTTATTGCAAATTCCATTATAAGACTGACCAGGGCATCAAAAACCTTTCTGTTGAAGATGCGGCGAGACTTTCCCAGGAAGATCCTGACTATGGCATCCGGGATCTTTTTAACGCCATTGCCACAGGAAAGTACCCCTCCTGGACTTTTTACATCCAGGTCATGACATTTAATCAGGCAGAAACTTTTCCATTTAATCCATTCGATCTCACCAAGGTTTGGCCTCACAAGGACTACCCTCTCATCCCAGTTGGTAAACTGGTCTTAAACCGGAATCCAGTTAATTACTTTGCTGAGGTTGAACAGATAGCCTTCGACCCAAGCAACATGCCACCTGGCATTGAGGCCAGTCCTGACAAAATGCTTCAGGGCCGCCTTTTTGCCTATCCTGACACTCACCGCCATCGCCTGGGACCCAATTATCTTCATATACCTGTGAACTGTCCCTACCGTGCTCGAGTGGCCAACTACCAGCGTGACGGCCCGATGTGCATGCAGGACAATCAGGGTGGTGCTCCAAATTACTACCCCAACAGCTTTGGTGCTCCGGAACAACAGCCTTCTGCCCTGGAGCACAGCATCCAATATTCTGGAGAAGTGCGGAGATTCAACACTGCCAATGATGATAACGTTACTCAGGTGCGGGCATTCTATGTGAACGTGCTGAATGAGGAACAGAGGAAACGTCTGTGTGAGAACATTGCCGGCCACCTGAAGGATGCACAAATTTTCATCCAGAAGAAAGCGGTCAAGAACTTCACTGAGGTCCACCCTGACTACGGGAGCCACATCCAGGCTCTTCTGGACAAGTACAATGCTGAGAAGCCTAAGAATGCGATTCACACCTTTGTGCAGTCCGGATCTCACTTGGCGGCAAGGGAGAAGGCAAATCTGTGA

Length: 1584

View AllClose