CD59 Clone BC001506

(No reviews yet) Write a Review
SKU:
CSB-CL004947HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
CD59
Gene ID:
966
Accession #:
BC001506
Vector:
pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

CD59 Clone BC001506 | Cusabio

Gene Name: CD59

Gene ID: 966

Accession Number: BC001506

Plasmid: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGGAATCCAAGGAGGGTCTGTCCTGTTCGGGCTGCTGCTCGTCCTGGCTGTCTTCTGCCATTCAGGTCATAGCCTGCAGTGCTACAACTGTCCTAACCCAACTGCTGACTGCAAAACAGCCGTCAATTGTTCATCTGATTTTGATGCGTGTCTCATTACCAAAGCTGGGTTACAAGTGTATAACAAGTGTTGGAAGTTTGAGCATTGCAATTTCAACGACGTCACAACCCGCTTGAGGGAAAATGAGCTAACGTACTACTGCTGCAAGAAGGACCTGTGTAACTTTAACGAACAGCTTGAAAATGGTGGGACATCCTTATCAGAGAAAACAGTTCTTCTGCTGGTGACTCCATTTCTGGCAGCAGCCTGGAGCCTTCATCCCTAA

Length: 387

View AllClose