null
Cusabio

IL28B Clone BC130314

(No reviews yet) Write a Review
SKU:
CSB-CL810313HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
IL28B
Gene ID:
282617
Accession #:
BC130314
Vector:
pENTR223.1 or pUC
€214.00

Description

IL28B Clone BC130314 | Cusabio

Gene Name: IL28B

Gene ID: 282617

Accession Number: BC130314

Plasmid: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGACCGGGGACTGCATGCCAGTGCTGGTGCTGATGGCCGCAGTGCTGACCGTGACTGGAGCAGTTCCTGTCGCCAGGCTCCGCGGGGCTCTCCCGGATGCAAGGGGCTGCCACATAGCCCAGTTCAAGTCCCTGTCTCCACAGGAGCTGCAGGCCTTTAAGAGGGCCAAAGATGCCTTAGAAGAGTCGCTTCTGCTGAAGGACTGCAAGTGCCGCTCCCGCCTCTTCCCCAGGACCTGGGACCTGAGGCAGCTGCAGGTGAGGGAGCGCCCCGTGGCTTTGGAGGCTGAGCTGGCCCTGACGCTGAAGGTTCTGGAGGCCACCGCTGACACTGACCCAGCCCTGGGGGATGTCTTGGACCAGCCCCTTCACACCCTGCACCATATCCTCTCCCAGCTCCGGGCCTGTATCCAGCCTCAGCCCACGGCAGGGCCCAGGACCCGGGGCCGCCTCCACCATTGGCTGCACCGGCTCCAGGAGGCCCCAAAAAAGGAGTCCCCTGGCTGCCTCGAGGCCTCTGTCACCTTCAACCTCTTCCGCCTCCTCACGCGAGACCTGAATTGTGTTGCCAGCGGGGACCTGTGTGTCTGA

Length: 591

View AllClose