null
Cusabio

ILF2 Clone BC000382 pENTR223.1

(No reviews yet) Write a Review
SKU:
CSB-CL614262HU
Availability:
3 to 5 Working Days
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ILF2
Gene ID:
3608
Accession #:
BC000382
Vector:
pENTR223.1
€214.00

Description

ILF2 Clone BC000382 pENTR223.1 | Cusabio

Gene Name: ILF2

Gene ID: 3608

Accession Number: BC000382

Plasmid: pENTR223.1

Sequence: ATGAGGGGTGACAGAGGCCGTGGTCGTGGTGGGCGCTTTGGTTCCAGAGGAGGCCCAGGAGGAGGGTTCAGGCCCTTTGTACCACATATCCCATTTGACTTCTATTTGTGTGAAATGGCCTTTCCCCGGGTCAAGCCAGCACCTGATGAAACTTCCTTCAGTGAGGCCTTGCTGAAGAGGAATCAGGACCTGGCTCCCAATTCTGCTGAACAGGCATCTATCCTTTCTCTGGTGACAAAAATAAACAATGTGATTGATAATCTGATTGTGGCTCCAGGGACATTTGAAGTGCAAATTGAAGAAGTTCGACAGGTGGGATCCTATAAAAAGGGGACAATGACTACAGGACACAATGTGGCTGACCTGGTGGTGATACTCAAGATTCTGCCAACGTTGGAAGCTGTTGCTGCCCTGGGGAACAAAGTCGTGGAAAGCCTAAGAGCACAGGATCCTTCTGAAGTTTTAACCATGCTGACCAACGAAACTGGCTTTGAAATCAGTTCTTCTGATGCTACAGTGAAGATTCTCATTACAACAGTGCCACCCAATCTTCGAAAACTGGATCCAGAACTCCATTTGGATATCAAAGTATTGCAGAGTGCCTTAGCAGCCATCCGACATGCCCGCTGGTTCGAGGAAAATGCTTCTCAGTCCACAGTTAAAGTTCTCATCAGACTACTGAAGGACTTGAGGATTCGTTTTCCTGGCTTTGAGCCCCTCACACCCTGGATCCTTGACCTACTAGGCCATTATGCTGTGATGAACAACCCCACCAGACAGCCTTTGGCCCTAAACGTTGCATACAGGCGCTGCTTGCAGATTCTGGCTGCAGGACTGTTCCTGCCAGGTTCAGTGGGTATCACTGACCCCTGTGAGAGTGGCAACTTTAGAGTACACACAGTCATGACCCTAGAACAGCAGGACATGGTCTGCTATACAGCTCAGACTCTCGTCCGAATCCTCTCACATGGTGGCTTTAGGAAGATCCTTGGCCAGGAGGGTGATGCCAGCTATCTTGCTTCTGAAATATCTACCTGGGATGGAGTGATAGTAACACCTTCAGAAAAGGCTTATGAGAAGCCACCAGAGAAGAAGGAAGGAGAGGAAGAAGAGGAGAATACAGAAGAACCACCTCAAGGAGAGGAAGAAGAAAGCATGGAAACTCAGGAGTGA

Length: 1173

View AllClose