null
Cusabio

IMP3 Clone BC011745

(No reviews yet) Write a Review
SKU:
CSB-CL873661HU2
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
IMP3
Gene ID:
55272
Accession #:
BC011745
Vector:
pENTR223.1 or pUC
€214.00

Description

IMP3 Clone BC011745 | Cusabio

Gene Name: IMP3

Gene ID: 55272

Accession Number: BC011745

Plasmid: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGTGCGGAAGCTTAAGTTCCACGAGCAGAAGCTGCTGAAGCAGGTGGACTTCCTGAACTGGGAGGTCACCGACCACAACCTGCACGAGCTGCGCGTGCTGCGGCGTTACCGGCTGCAGCGGCGGGAGGACTACACGCGCTACAACCAGCTGAGCCGTGCCGTGCGTGAGCTGGCGCGGCGCCTGCGCGACCTGCCCGAACGCGACCAGTTCCGCGTGCGCGCTTCGGCCGCGCTGCTGGACAAGCTGTATGCTCTCGGCTTGGTGCCCACGCGCGGTTCGCTGGAGCTCTGCGACTTCGTCACGGCCTCGTCCTTCTGCCGCCGCCGCCTCCCCACCGTGCTCCTCAAGCTGCGCATGGCGCAGCACCTTCAGGCTGCCGTGGCCTTTGTGGAGCAAGGGCACGTACGCGTGGGCCCTGACGTGGTTACCGACCCCGCCTTCCTTGTCACGCGCAGCATGGAGGACTTTGTCACTTGGGTGGACTCGTCCAAGATCAAGCGGCACGTGCTAGAGTACAATGAGGAGCGCGATGACTTCGATCTGGAAGCCTAG

Length: 555

View AllClose