null
Cusabio

INHA Clone BC006391 pENTR223.1

(No reviews yet) Write a Review
SKU:
CSB-CL011718HU
Availability:
3 to 5 Working Days
Size:
10 μg plasmid + 200μl Glycerol
Gene:
INHA
Gene ID:
3623
Accession #:
BC006391
Vector:
pENTR223.1
€214.00

Description

INHA Clone BC006391 pENTR223.1 | Cusabio

Gene Name: INHA

Gene ID: 3623

Accession Number: BC006391

Plasmid: pENTR223.1

Sequence: ATGGTGCTGCACCTACTGCTCTTCTTGCTGCTGACCCCACAGGGTGGGCACAGCTGCCAGGGGCTGGAGCTGGCCCGGGAACTTGTTCTGGCCAAGGTGAGGGCCCTGTTCTTGGATGCCTTGGGGCCCCCCGCGGTGACCAGGGAAGGTGGGGACCCTGGAGTCAGGCGGCTGCCCCGAAGACATGCCCTGGGGGGCTTCACACACAGGGGCTCTGAGCCCGAGGAAGAGGAGGATGTCTCCCAAGCCATCCTTTTCCCAGCCACAGATGCCAGCTGTGAGGACAAGTCAGCTGCCAGAGGGCTGGCCCAGGAGGCTGAGGAGGGCCTCTTCAGATACATGTTCCGGCCATCCCAGCATACACGCAGCCGCCAGGTGACTTCAGCCCAGCTGTGGTTCCACACCGGGCTGGACAGGCAGGGCACAGCAGCCTCCAATAGCTCTGAGCCCCTGCTAGGCCTGCTGGCACTGTCACCGGGAGGACCCGTGGCTGTGCCCATGTCTTTGGGCCATGCTCCCCCTCACTGGGCCGTGCTGCACCTGGCCACCTCTGCTCTCTCTCTGCTGACCCACCCCGTCCTGGTGCTGCTGCTGCGCTGTCCCCTCTGTACCTGCTCAGCCCGGCCTGAGGCCACGCCCTTCCTGGTGGCCCACACTCGGACCAGACCACCCAGTGGAGGGGAGAGAGCCCGACGCTCAACTCCCCTGATGTCCTGGCCTTGGTCTCCCTCTGCTCTGCGCCTGCTGCAGAGGCCTCCGGAGGAACCGGCTGCCCATGCCAACTGCCACAGAGTAGCACTGAACATCTCCTTCCAGGAGCTGGGCTGGGAACGGTGGATCGTGTACCCTCCCAGTTTCATCTTCCACTACTGTCATGGTGGTTGTGGGCTGCACATCCCACCAAACCTGTCCCTTCCAGTCCCTGGGGCTCCCCCTACCCCAGCCCAGCCCTACTCCTTGCTGCCAGGGGCCCAGCCCTGCTGTGCTGCTCTCCCAGGGACCATGAGGCCCCTACATGTCCGCACCACCTCGGATGGAGGTTACTCTTTCAAGTATGAGACAGTGCCCAACCTTCTCACGCAGCACTGTGCTTGTATCTAA

Length: 1101

View AllClose