Cusabio
KRTAP3-3 Clone BC069448
- SKU:
- CSB-CL874846HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP3-3
- Gene ID:
- 85293
- Accession #:
- BC069448
- Vector:
- pENTR223.1 or pUC
Description
KRTAP3-3 Clone BC069448 | Cusabio
Gene Name: KRTAP3-3
Gene ID: 85293
Accession Number: BC069448
Plasmid: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGGATTGCTGTGCCTCTCGAGGCTGCAGTGTCCCCACCGGGCCTGCCACCACCATCTGCTCCTCCGACAAATCCTGTCGCTGTGGAGTCTGCCTGCCCAGCACCTGCCCACACACAGTTTGGTTACTGGAGCCCACCTGCTGTGACAACTGTCCCCCACCCTGCCACATTCCTCAGCCCTGTGTGCCCACCTGCTTCCTGCTCAACTCCTGCCAGCCAACTCCAGGCCTGGAGACCCTCAACCTCACCACCTTCACTCAGCCCTGCTGTGAGCCCTGCCTCCCAAGAGGCTGCTAA
Length: 297
Related Products
KRTAP3-2 Clone BC034582
Cusabio
$256.80
KRTAP3-2 Clone BC034582 | CusabioGene Name: KRTAP3-2Gene ID: 83897Accession Number: BC034582Plasmid: Vector will be determined during the manufacturing process, either pENTR223.1 or pUCSequence:...
KRTAP3-1 Clone BC113077
Cusabio
$256.80
KRTAP3-1 Clone BC113077 | CusabioGene Name: KRTAP3-1Gene ID: 83896Accession Number: BC113077Plasmid: Vector will be determined during the manufacturing process, either pENTR223.1 or pUCSequence:...
pCR-BluntII-TOPO-KRTAP3-1 Plasmid | PVT18056
Nova Lifetech
$277.20
Product Name: pCR-BluntII-TOPO-KRTAP3-1 Plasmid
Cat#: PVT18056Supplier: Nova Lifetech / Life Science MarketAvailable with 5 to 7 Working days.
pCMV-SPORT6-KRTAP3-2 Plasmid | PVT18060
Nova Lifetech
$277.20
Product Name: pCMV-SPORT6-KRTAP3-2 Plasmid
Cat#: PVT18060Supplier: Nova Lifetech / Life Science MarketAvailable with 5 to 7 Working days.
KRTAP10-3 Clone BC133677
Cusabio
$256.80
KRTAP10-3 Clone BC133677 | CusabioGene Name: KRTAP10-3Gene ID: 386682Accession Number: BC133677Plasmid: Vector will be determined during the manufacturing process, either pENTR223.1 or pUCSequence:...
KRTAP13-3 Clone BC103965
Cusabio
$256.80
KRTAP13-3 Clone BC103965 | CusabioGene Name: KRTAP13-3Gene ID: 337960Accession Number: BC103965Plasmid: Vector will be determined during the manufacturing process, either pENTR223.1 or pUCSequence:...
Adeno-3™ pPromoter Cloning Kit | A310
ABM Good
$1,120.80
abm | Adeno-3™ pPromoter Cloning Kit | A310Quantity:1 KitTiter:N/AShipping Condition:Refer to Manual/DatasheetStorage Condition:Refer to Manual/Datasheet
Adeno-3™ pPromoter Complete Cloning Kit | A300
ABM Good
$1,435.20
abm | Adeno-3™ pPromoter Complete Cloning Kit | A300Quantity:1 KitTiter:N/AShipping Condition:Refer to Manual/DatasheetStorage Condition:Refer to Manual/Datasheet
RNASE9 Clone BC130311
Cusabio
$256.80
RNASE9 Clone BC130311 | CusabioGene Name: RNASE9Gene ID: 390443Accession Number: BC130311Plasmid: Vector will be determined during the manufacturing process, either pENTR223.1 or pUCSequence:...