RLN2 Clone BC126415

(No reviews yet) Write a Review
SKU:
CSB-CL019750HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
RLN2
Gene ID:
6019
Accession #:
BC126415
Vector:
pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

RLN2 Clone BC126415 | Cusabio

Gene Name: RLN2

Gene ID: 6019

Accession Number: BC126415

Plasmid: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGCCTCGCCTGTTTTTTTTCCACCTGCTAGGAGTCTGTTTACTACTGAACCAATTTTCCAGAGCAGTCGCGGACTCATGGATGGAGGAAGTTATTAAATTATGCGGCCGCGAATTAGTTCGCGCGCAGATTGCCATTTGCGGCATGAGCACCTGGAGCAAAAGGTCTCTGAGCCAGGAAGATGCTCCTCAGACACCTAGACCAGTGGCAGAAATTGTGCCATCCTTCATCAACAAAGATACAGAAACCATAAATATGATGTCAGAATTTGTTGCTAATTTGCCACAGGAGCTGAAGTTAACCCTGTCTGAGATGCAGCCAGCATTACCACAGCTACAACAACATGTACCTGTATTAAAAGATTCCAGTCTTCTCTTTGAAGAATTTAAGAAACTTATTCGCAATAGACAAAGTGAAGCCGCAGACAGCAGTCCTTCAGAATTAAAATACTTAGGCTTGGATACTCATTCTCGAAAAAAGAGACAACTCTACAGTGCATTGGCTAATAAATGTTGCCATGTTGGTTGTACCAAAAGATCTCTTGCTAGATTTTGCTGA

Length: 558

View AllClose