null

SCG2 Clone BC022509

(No reviews yet) Write a Review
SKU:
CSB-CL020808HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
SCG2
Gene ID:
7857
Accession #:
BC022509
Vector:
pENTR223.1 or pUC
€347.00
Frequently bought together:

Description

SCG2 Clone BC022509 | Cusabio

Gene Name: SCG2

Gene ID: 7857

Accession Number: BC022509

Plasmid: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCTGAAGCAAAGACCCACTGGCTTGGAGCAGCCCTGTCTCTTATCCCTTTAATTTTCCTCATCTCTGGGGCTGAAGCAGCTTCATTTCAGAGAAACCAGCTGCTTCAGAAAGAACCAGACCTCAGGTTGGAAAATGTCCAAAAGTTTCCCAGTCCTGAAATGATCAGGGCTTTGGAGTACATAGAAAACCTCCGACAACAAGCTCATAAGGAAGAAAGCAGCCCAGATTATAATCCCTACCAAGGTGTCTCTGTCCCCCTTCAGCAAAAAGAAAATGGCGATGAAAGCCACTTGCCCGAGAGGGATTCACTGAGTGAAGAAGACTGGATGAGAATAATACTCGAAGCTTTGAGACAGGCTGAAAATGAGCCTCAGTCTGCACCAAAAGAAAATAAGCCCTATGCCTTGAATTCAGAAAAGAACTTTCCAATGGACATGAGTGATGATTATGAGACACAGCAGTGGCCAGAAAGAAAGCTTAAGCACATGCAATTCCCTCCTATGTATGAAGAGAATTCCAGGGATAACCCCTTTAAACGCACAAATGAAATAGTGGAGGAACAATATACTCCTCAAAGCCTTGCTACATTGGAATCTGTCTTCCAAGAGCTGGGGAAACTGACAGGACCAAACAACCAGAAACGTGAGAGGATGGATGAGGAGCAAAAACTTTATACGGATGATGAAGATGATATCTACAAGGCTAATAACATTGCCTATGAAGATGTGGTCGGGGGAGAAGACTGGAACCCAGTAGAGGAGAAAATAGAGAGTCAAACCCAGGAAGAGGTGAGAGACAGCAAAGAGAATATAGAAAAAAATGAACAAATCAATGATGAGATGAAACGCTCAGGGCAGCTTGGCATCCAGGAAGAAGGTCTTCGGAAAGAGAGTAAAGACCAACTCTCAGATGATGTCTCCAAAGTAATTGCCTATTTGAAAAGGTTAGTAAATGCTGCAGGAAGTGGGAGGTTACAGAATGGGCAAAATGGGGAAAGGGCCACCAGGCTTTTTGAGAAACCTCTTGATTCTCAGTCTATTTATCAGCTGATTGAAATCTCAAGGAATTTACAGATACCCCCAGAAGACTTAATTGAGATGCTCAAAACTGGGGAGAAGCCGAATGGATCAGTGGAACCGGAGCGGGAGCTTGACCTTCCTGTTGACCTAGATGACATCTCAGAGGCTGACTTAGACCATCCAGACCTGTTCCAAAATAGGATGCTCTCCAAGAGTGGCTACCCTAAAACACCTGGTGGTGCTGGGACTGAGGCCCTACCAGACGGGCTCAGTGTTGAGGATATTTTAAATCTTTTAGGGATGGAGAGTGCAGCAAATCAGAAAACGTCGTATTTTCCCAATCCATATAACCAGGAGAAAGTTCTGCCAAGGCTCCCTTATGGTGCTGGAAGATCTAGATCGAACCAGCTTCCCAAAGCTGCCTGGATTCCACATGTTGAAAACAGACAGATGGCATATGAAAACCTGAACGACAAGGATCAAGAATTAGGTGAGTACTTGGCCAGGATGCTAGTTAAATACCCTGAGATCATTAATTCAAACCAAGTGAAGCGAGTTCCTGGTCAAGGCTCATCTGAAGGTGACCTGCAGGAAGAGGAACAAATTGAGCAGGCCATCAAAGAGCATTTGAATCAAGGCAGCTCTCAGGAGACTGACAAGCTGGCCCCGGTGAGCAAAAGGTTCCCTGTGGGGCCCCCGAAGAATGATGATACCCCAAATAGGCAGTACTGGGATGAAGATCTGTTAATGAAAGTGCTGGAATACCTCAACCAAGAAAAGGCAGAAAAGGGAAGGGAGCATATTGCTAAGAGAGCAATGGAAAATATGTAA

Length: 1854

View AllClose