null

SCML4 Clone BC033286

(No reviews yet) Write a Review
SKU:
CSB-CL839782HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
SCML4
Gene ID:
256380
Accession #:
BC033286
Vector:
pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

SCML4 Clone BC033286 | Cusabio

Gene Name: SCML4

Gene ID: 256380

Accession Number: BC033286

Plasmid: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGCCCTGCCAGAGAACAGCTTGGATAGGTTGCGACAGGCAGAGAACCCCCCCATTCCACTGGAGAGAGATCAAGTCTCGGGTTCTCATGACTCCCTTAGCCCTCTCACCTCCGCGGAGTACCCCAGAGCCCGACCTCAGCTCCATCCCTCAGGACGCAGCCACGGTCCCCAGCTTGGCGGCCCCACAGGCTCTCACAGTCTGCCTCTACATCAACAAGCAGGCCAATGCGGGGCCCTATCTGGAGAGGAAGAAGGTGCAGCAGCTCCCGGAGCATTTTGGGCCCGAGCGGCCATCGGCGGTGCTGCAGCAGGCCGTCCAAGCCTGCATCGACTGCGCCCACCAGCAGAAGCTGGTCTTCTCCCTGGTCAAGCAGGGCTATGGTGGTGAGATGGTGTCAGTCTCGGCTTCCTTTGATGGCAAACAGCACCTGCGGAGCCTGCCTGTGGTGAACAGCATCGGCTATGTCCTCCGCTTCCTCGCCAAGCTGTGCCGAAGCCTCCTGTGCGATGACCTCTTCAGCCACCAGCCCTTCCCCAGGGGCTGCAGTGCCTCTGAGAAAGTCCAGGAGAAAGAGGAAGGGAGGATGGAATCAGTCAAGACAGTCACCACCGAAGAGTACCTGGTGAACCCTGTGGGCATGAACCGCTACAGCGTGGACACCTCCGCCTCCACCTTTAACCACAGGGGCTCCTTGCACCCCTCCTCCTCGCTGTACTGCAAGAGGCAGAACTCTGGAGACAGCCACCTTGGGGGTGGTCCTGCTGCCACCGCTGGTGGTCCCCGCACTAGCCCCATGTCTTCTGGTGGCCCCTCGGCACCTGGGCTGAGGCCTCCAGCCTCCAGCCCCAAGAGAAACACGACCTCTCTTGAAGGAAACAGATGTGGTAATGTAATGCATGCATCAGCTTCCCACTGA

Length: 918

View AllClose