SCNM1 Clone BC000264

(No reviews yet) Write a Review
SKU:
CSB-CL020847HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
SCNM1
Gene ID:
79005
Accession #:
BC000264
Vector:
pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

SCNM1 Clone BC000264 | Cusabio

Gene Name: SCNM1

Gene ID: 79005

Accession Number: BC000264

Plasmid: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGTCTTTCAAGAGGGAAGGAGACGATTGGAGTCAACTCAATGTGCTCAAAAAAAGAAGAGTCGGGGACCTCCTAGCCAGTTACATTCCAGAGGATGAGGCGCTGATGCTTCGGGATGGACGCTTTGCTTGTGCCATCTGCCCCCATCGACCGGTACTGGACACCCTGGCCATGCTGACTGCCCACCGTGCAGGCAAGAAACATCTGTCCAGCTTGCAGCTTTTCTATGGCAAGAAGCAGCCGGGAAAGGAAAGAAAGCAGAATCCAAAACATCAGAATGAATTGAGAAGGGAAGAAACCAAAGCTGAGGCTCCTCTGCTAACTCAGACACGACTTATCACCCAGAGTGCTCTGCACAGAGCTCCCCACTATAACAGTTGCTGCCGCCGGAAGTACAGACCAGAAGCCCCTGGTCCCTCTGTCTCCCTTTCCCCTATGCCACCCTCAGAGGTCAAACTCCAAAGTGGGAAGATCAGTAGGGAACCTGAACCTGCGGCTGGCCCACAGGCCGAGGAGTCAGCAACTGTCTCAGCCCCTGCACCCATGAGCCCCACAAGAAGACGAGCCCTGGACCATTATCTCACCCTTCGAAGCTCTGGATGGATCCCAGATGGACGAGGTCGATGGGTAAAAGATGAAAATGTTGAGTTTGACTCTGATGAGGAGGAACCACCTGATCTCCCCTTGGACTGA

Length: 693

View AllClose