null

SCRG1 Clone BC017583

(No reviews yet) Write a Review
SKU:
CSB-CL530448HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
SCRG1
Gene ID:
11341
Accession #:
BC017583
Vector:
pENTR223.1 or pUC
£184.04
Frequently bought together:

Description

SCRG1 Clone BC017583 | Cusabio

Gene Name: SCRG1

Gene ID: 11341

Accession Number: BC017583

Plasmid: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGAAACTGATGGTACTTGTTTTCACCATTGGGCTAACTTTGCTGCTAGGAGTTCAAGCCATGCCTGCAAATCGCCTCTCTTGCTACAGAAAGATACTAAAAGATCACAACTGTCACAACCTTCCGGAAGGAGTAGCTGACCTGACACAGATTGATGTCAATGTCCAGGATCATTTCTAA

Length: 180

View AllClose