null

SDC4 Clone BC030805

(No reviews yet) Write a Review
SKU:
CSB-CL327046HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
SDC4
Gene ID:
6385
Accession #:
BC030805
Vector:
pENTR223.1 or pUC
£184.04
Frequently bought together:

Description

SDC4 Clone BC030805 | Cusabio

Gene Name: SDC4

Gene ID: 6385

Accession Number: BC030805

Plasmid: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCCCCCGCCCGTCTGTTCGCGCTGCTGCTGTTCTTCGTAGGCGGAGTCGCCGAGTCGATCCGAGAGACTGAGGTCATCGACCCCCAGGACCTCCTAGAAGGCCGATACTTCTCCGGAGCCCTACCAGACGATGAGGATGTAGTGGGGCCCGGGCAGGAATCTGATGACTTTGAGCTGTCTGGCTCTGGAGATCTGGATGACTTGGAAGACTCCATGATCGGCCCTGAAGTTGTCCATCCCTTGGTGCCTCTAGATAACCATATCCCTGAGAGGGCAGGGTCTGGGAGCCAAGTCCCCACCGAACCCAAGAAACTAGAGGAGAATGAGGTTATCCCCAAGAGAATCTCACCCGTTGAAGAGAGTGAGGATGTGTCCAACAAGGTGTCAATGTCCAGCACTGTGCAGGGCAGCAACATCTTTGAGAGAACGGAGGTCCTGGCAGCTCTGATTGTGGGTGGCATCGTGGGCATCCTCTTTGCCGTCTTCCTGATCCTACTGCTCATGTACCGTATGAAGAAGAAGGATGAAGGCAGCTATGACCTGGGCAAGAAACCCATCTACAAGAAAGCCCCCACCAATGAGTTCTACGCGTGA

Length: 597

View AllClose