null

SERPING1 Clone BC011171 pENTR223.1

(No reviews yet) Write a Review
SKU:
CSB-CL021086HU
Availability:
3 to 5 Working Days
Size:
10 μg plasmid + 200μl Glycerol
Gene:
SERPING1
Gene ID:
710
Accession #:
BC011171
Vector:
pENTR223.1
€347.00
Frequently bought together:

Description

SERPING1 Clone BC011171 pENTR223.1 | Cusabio

Gene Name: SERPING1

Gene ID: 710

Accession Number: BC011171

Plasmid: pENTR223.1

Sequence: ATGGCCTCCAGGCTGACCCTGCTGACCCTCCTGCTGCTGCTGCTGGCTGGGGATAGAGCCTCCTCAAATCCAAATGCTACCAGCTCCAGCTCCCAGGATCCAGAGAGTTTGCAAGACAGAGGCGAAGGGAAGGTCGCAACAACAGTTATCTCCAAGATGCTATTCGTTGAACCCATCCTGGAGGTTTCCAGCTTGCCGACAACCAACTCAACAACCAATTCAGCCACCAAAATAACAGCTAATACCACTGATGAACCCACCACACAACCCACCACAGAGCCCACCACCCAACCCACCATCCAACCCACCCAACCAACTACCCAGCTCCCAACAGATTCTCCTACCCAGCCCACTACTGGGTCCTTCTGCCCAGGACCTGTTACTCTCTGCTCTGACTTGGAGAGTCATTCAACAGAGGCCGTGTTGGGGGATGCTTTGGTAGATTTCTCCCTGAAGCTCTACCACGCCTTCTCAGCAATGAAGAAGGTGGAGACCAACATGGCCTTTTCCCCATTCAGCATCGCCAGCCTCCTTACCCAGGTCCTGCTCGGGGCTGGGGAGAACACCAAAACAAACCTGGAGAGCATCCTCTCTTACCCCAAGGACTTCACCTGTGTCCACCAGGCCCTGAAGGGCTTCACGACCAAAGGTGTCACCTCAGTCTCTCAGATCTTCCACAGCCCAGACCTGGCCATAAGGGACACCTTTGTGAATGCCTCTCGGACCCTGTACAGCAGCAGCCCCAGAGTCCTAAGCAACAACAGTGACGCCAACTTGGAGCTCATCAACACCTGGGTGGCCAAGAACACCAACAACAAGATCAGCCGGCTGCTAGACAGTCTGCCCTCCGATACCCGCCTTGTCCTCCTCAATGCTATCTACCTGAGTGCCAAGTGGAAGACAACATTTGATCCCAAGAAAACCAGAATGGAACCCTTTCACTTCAAAAACTCAGTTATAAAAGTGCCCATGATGAATAGCAAGAAGTACCCTGTGGCCCATTTCATTGACCAAACTTTGAAAGCCAAGGTGGGGCAGCTGCAGCTCTCCCACAATCTGAGTTTGGTGATCCTGGTACCCCAGAACCTGAAACATCGTCTTGAAGACATGGAACAGGCTCTCAGCCCTTCTGTTTTCAAGGCCATCATGGAGAAACTGGAGATGTCCAAGTTCCAGCCCACTCTCCTAACACTACCCCGCATCAAAGTGACGACCAGCCAGGATATGCTCTCAATCATGGAGAAATTGGAATTCTTCGATTTTTCTTATGACCTTAACCTGTGTGGGCTGACAGAGGACCCAGATCTTCAGGTTTCTGCGATGCAGCACCAGACAGTGCTGGAACTGACAGAGACTGGGGTGGAGGCGGCTGCAGCCTCCGCCATCTCTGTGGCCCGCACCCTGCTGGTCTTTGAAGTGCAGCAGCCCTTCCTCTTCATGCTCTGGGACCAGCAGCACAAGTTCCCTGTCTTCATGGGGCGAGTATATGACCCCAGGGCCTGA

Length: 1503

View AllClose