ZSWIM2 Clone BC031094

(No reviews yet) Write a Review
SKU:
CSB-CL854109HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ZSWIM2
Gene ID:
151112
Accession #:
BC031094
Vector:
pENTR223.1 or pUC
zł1,589.26
Frequently bought together:

Description

ZSWIM2 Clone BC031094 | Cusabio

Gene Name: ZSWIM2

Gene ID: 151112

Accession Number: BC031094

Plasmid: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGCTTCGCCGAGGCTATAAGGCCTCTGAAAGGCGAAGACACTTGAGCGAGAGGCTCAGCTGGCACCAAGACCAGGCGCTGAGTAGCAGCATCTACCTCCTACGAGAGATGGGCCCCACTGGCTTCCTGCTGAGGGAGGAGGAGCCGGAATACATGGATTTCCGAGTTTTTCTAGGAAATCCTCACGTTTGTAACTGTTCCACATTTCCGAAAGGAGGGGAACTTTGTAAGCATATCTGCTGGGTCTTGTTGAAAAAATTCGAGCTTCCAAGGAACCATGAATCTGCTTTACAACTGGGTCTTGGAGAAAGAGAGATAAGTGACTTGCTTCGGGGGATACATCGAGTTCAAACTCCCCAACCAGGAACAAATGACGAGAATGAACATGTTGAAGAAGATGGGTACATTAAACAGAAGGAAATTGATTCAGAGGATATCTGCTCTATTTGTCAAGAGCTACTTTTAGAGAAAAAGCTTCCTGTCACCTTTTGCAGGTTTGGCTGTGGCAATAGTATTCATATAAAATGCATGAAGATCTTAGCTAATTATCAGAGTACATCAAACACTTCCATGTTGAAATGTCCTCTGTGCAGGAAAGAGTTTGCACCATTAAAACTGATTTTGGAGGAATTCAAAAACTCTAGCAAACTAGTAGCTGCAGCAGAAAAAGAGAGACTGGACAAACACCTTGGGATTCCCTGTAATAACTGCAAACAGTTTCCAATTGAGGGGAAGTGTTATAAGTGTACCGAATGCATAGAATATCACTTATGCCAGGAATGTTTTGATAGCTACTGCCATCTTTCCCACACGTTTACATTTCGTGAGAAAAGAAACCAAAAATGGAGATCACTAGAAAAAAGAGCAGATGAAGTTGTAAAATACATAGATACTAAAAATGAGACTGAAGAAAAGATGTCACATTTTCAAGAAAAGCAAGGCCAAGTTTACACACCAAAACACATTGTAAGATCACTGCCTCTCCAACTGATTACTAAGAATAGTAAGCTGCTTGCTCCAGGCTACCAGTGTCTACTTTGTTTGAAGGCATTTCATCTTGGTCAACATACAAGATTGCTACCATGTACTCACAAGTTTCACAGGAAGTGTATTGACAACTGGTTATTCCACAAGTGCAATTCATGCCCTATTGGTGGACAAGTTATATATAACCCTTTAACTTGGAAAAATTCAGCAGTGAATGGACAAGCACATCAGTCTGTTTCAAACAGAGACATCATTCATCTATCAAAGCAGAAAGAACCAGATCTTTTTATTCCTGGTACTGGATTAGTCTTAAAACAAAATAGACTTGGAATTTTACCTAGCATACCTCAGTGTAATTTTGATGAATTGAATACACCTCAAAGCCCAAAAGATGCCTATGAAAATACAACAATAGATAATCTATGCTCTATCAAATTAGATAATTCAAATTCAAAAAAATTAACCTATGAATATAAAATTAGCCAACATTTTCCCAGGTATCTTCAAGATTTACCCACTGTATCATTTGGGAAAATACCATCTCAAACACTGCTTCCTCCTATTGTTCATAAGAATATTGTATGTCCCACTGCAATGGAAAGTCCATGCATCAGTGGAAAATATCACACTAGTCTAAGCCGGGTGACCAAAGGCTGTAAATGTAATAACCACAACCTAAAGAAGACTCCTGCCACTAAAATAAGAGAGGACAACAAGCGATCAACTTTACTTCCAGAGGATTTCAATCTTATTGTCAATTGGAGCACAGCTAAACTTAGTTTGTCTAAAAGGTATAGTAACTGTATGGGGGAAATTACACGAAAATGTAGTCATCTATCAAGACAGCCTGTGTCTCACTCTGTAAATACAAAAAGTACTGAGCTATCTTTAATAATAGAAGGGGTTCAATTGTGA

Length: 1902

View AllClose