ZWINT Clone BC020979

(No reviews yet) Write a Review
SKU:
CSB-CL527261HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ZWINT
Gene ID:
11130
Accession #:
BC020979
Vector:
pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

ZWINT Clone BC020979 | Cusabio

Gene Name: ZWINT

Gene ID: 11130

Accession Number: BC020979

Plasmid: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGAGGCAGCGGAGACAGAGGCGGAAGCTGCAGCCCTAGAGGTCCTGGCTGAGGTGGCAGGCATCTTGGAACCTGTAGGCCTGCAGGAGGAGGCAGAACTGCCAGCCAAGATCCTGGTTGAGTTTGTGGTGGACTCTCAGAAGAAAGACAAGCTGCTCTGCAGCCAGCTTCAGGTAGCGGATTTCCTGCAGAACATCCTGGCTCAGGAGGACACTGCTAAGGGTCTCGACCCCTTGGCTTCTGAAGACACGAGCCGACAGAAGGCAATTGCAGCTAAGGAACAATGGAAAGAGCTGAAGGCCACCTACAGGGAGCACGTAGAGGCCATCAAAATTGGCCTCACCAAGGCCCTGACTCAGATGGAGGAAGCCCAGAGGAAACGGACACAACTCCGGGAAGCCTTTGAGCAGCTCCAGGCCAAGAAACAAATGGCCATGGAGAAACGCAGAGCAGTCCAGAACCAGTGGCAGCTACAACAGGAGAAGCATCTGCAGCATCTGGCGGAGGTTTCTGCAGAGGTGAGGGAGCGTAAGACAGGGACTCAGCAGGAGCTTGACGGGGTGTTTCAGAAACTTGGAAACCTGAAGCAGCAGGCAGAACAGGAGCGGGACAAGCTGCAGAGGTATCAGACCTTCCTCCAGCTTCTGTATACCCTGCAGGGTAAGCTGTTGTTCCCTGAGGCTGAGGCTGAGGCAGAGAATCTTCCAGATGATAAACCCCAGCAGCCGACTCGACCCCAGGAGCAGAGTACAGGAGACACCATGGGGAGAGACCCTGGTGTGTCCTTCAAGGCTGTTGGTCTACAACCTGCTGGAGATGTAAATTTGCCATGA

Length: 834

View AllClose