ZXDC Clone BC002940

(No reviews yet) Write a Review
SKU:
CSB-CL648494HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ZXDC
Gene ID:
79364
Accession #:
BC002940
Vector:
pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

ZXDC Clone BC002940 | Cusabio

Gene Name: ZXDC

Gene ID: 79364

Accession Number: BC002940

Plasmid: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGAAGGCGCACATGGTCAGACAGCACAGCCGGCGCCAAGATCTCTTACCTCAGCTAGAAGCTCCGAGTTCTCTTACTCCCAGCAGTGAACTCAGCAGCCCAGGCCAAAGTGAGCTCACTAACATGGATCTTGCTGCACTCTTCTCTGACACACCTGCCAATGCTAGTGGTTCTGCAGGTGGGTCGGATGAGGCTCTGAACTCCGGAATCCTGACTATTGACGTCACTTCTGTGAGCTCCTCTCTGGGAGGGAACCTCCCTGCTAATAATAGCTCCCTAGGGCCGATGGAACCCCTGGTCCTGGTGGCCCACAGTGATATTCCCCCAAGCCTGGACAGCCCTCTGGTTCTCGGGACAGCAGCCACGGTTCTGCAGCAGGGCAGCTTCAGTGTGGATGACGTGCAGACTGTGAGTGCAGGAGCATTAGGCTGTCTGGTGGCTCTGCCCATGAAGAACTTGAGTGACGACCCACTGGCTTTGACCTCCAATAGTAACTTAGCAGCACATATCACCACACCGACCTCTTCGAGCACCCCCCGAGAAAATGCCAGTGTCCCGGAACTGCTGGCTCCAATCAAGGTGGAGCCGGACTCGCCTTCTCGCCCAGGAGCAGTTGGGCAGCAGGAAGGAAGCCATGGGCTGCCCCAGTCCACGTTGCCCAGTCCAGCAGAGCAGCACGGTGCCCAGGACACAGAGCTCAGTGCAGGCACTGGCAACTTCTATTTGGAAAGTGGGGGCTCAGCAAGAACTGATTACCGAGCCATTCAACTAGCCAAGGAAAAAAAGCAGAGAGGAGCGGGGAGCAATGCAGGAGCCTCACAGTCTACTCAGAGAAAAATAAAAGAAGGCAAAATGAGTCCTCCCCATTTCCATGCAAGCCAGAACAGTTGGTTGTGTGGGAGCCTCGTGGTGCCCAGCGGAGGACGGCCAGGACCAGCTCCAGCAGCTGGGGTGCAGTGCGGGGCGCAGGGCGTCCAGGTCCAGCTGGTGCAGGATGACCCCTCCGGCGAAGGTGTCCTGCCCTCGGCCCGCGGCCCAGCCACCTTCCTCCCCTTCCTCACTGTGGACCTGCCCGTCTACGTCCTCCAGGAGGTGCTCCCCTCATCTGGAGGCCCTGCTGGACCGGAGGCCACCCAGTTCCCAGGAAGCACTATCAACCTGCAGGATCTGCAGTGA

Length: 1176

View AllClose