ZYG11B Clone BC029832

(No reviews yet) Write a Review
SKU:
CSB-CL887185HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ZYG11B
Gene ID:
79699
Accession #:
BC029832
Vector:
pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

ZYG11B Clone BC029832 | Cusabio

Gene Name: ZYG11B

Gene ID: 79699

Accession Number: BC029832

Plasmid: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGAAAAAACAAAGCCAGAAATTTTAAAGCTTGTGGTTACTGGGATGAGAAACCACCCTATGAATTTGCCAGTGCAACTGGCTGCAAGCGCCTGTGTATTTAACTTAACCAAGCAGGATCTTGCTGCAGGAATGCCTGTCCGACTCCTGGCTGATGTGACCCATTTGCTGCTCAAAGCCATGGAACATTTTCCCAATCACCAGCAGTTACAGAAGAATTGCCTCCTTTCACTTTGCAGTGACCGGATCCTTCAAGATGTTCCATTTAACAGGTTTGAAGCAGCCAAGCTTGTCATGCAGTGGCTTTGCAACCATGAGGATCAAAACATGCAAAGGATGGCAGTTGCTATCATTTCTATCCTGGCTGCCAAGCTTTCTACAGAACAAACTGCACAGCTTGGTACTGAGCTCTTCATTGTCAGGCAACTTCTTCAAATAGTGAAGCAGAAAACCAATCAAAATTCAGTGGACACTACATTGAAATTTACTTTGAGTGCACTTTGGAACCTCACAGATGAATCTCCAACCACTTGTAGACACTTTATTGAAAACCAAGGGTTAGAACTCTTCATGAGGGTTCTAGAGTCTTTCCCAACTGAGTCATCCATTCAGCAGAAAGTTCTAGGACTTTTGAACAATATAGCTGAAGTACAAGAATTACATTCTGAATTAATGTGGAAAGATTTTATAGACCACATCAGTAGTCTCCTACACAGTGTGGAAGTGGAAGTCAGTTACTTTGCAGCTGGAATTATTGCCCATTTAATATCCAGAGGTGAACAAGCTTGGACATTGAGTCGTAGCCAGAGGAATTCTCTGCTGGATGATTTGCATTCAGCTATTTTGAAATGGCCAACTCCAGAGTGTGAGATGGTAGCATACAGGTCCTTTAATCCATTTTTCCCATTACTTGGCTGTTTCACAACACCAGGAGTTCAGCTATGGGCAGTTTGGGCCATGCAACATGTCTGCAGCAAGAATCCTTCAAGGTATTGCAGCATGCTGATTGAAGAAGGAGGATTGCAGCATTTATACAACATCAAAGATCATGAACATACTGATCCCCATGTCCAACAGATTGCTGTGGCCATTCTGGATAGCTTAGAAAAACACATTGTGCGCCATGGGAGGCCACCTCCCTGTAAAAAACAGCCCCAAGCCAGACTAAATTGA

Length: 1173

View AllClose