null

A4GALT Clone BC017068 pUC

(No reviews yet) Write a Review
SKU:
CSB-CL868276HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
A4GALT
Gene ID:
53947
Accession #:
BC017068
Vector:
pUC
€375.00
Frequently bought together:

Description

A4GALT Clone BC017068 pUC | Cusabio

Gene Name: A4GALT

Gene ID: 53947

Accession Number: BC017068

Plasmid: pUC

Sequence: ATGTCCAAGCCCCCCGACCTCCTGCTGCGGCTGCTCCGGGGCGCCCCAAGGCAGCGGGTCTGCACCCTGTTCATCATCGGCTTCAAGTTCACGTTTTTCGTCTCCATCATGATCTACTGGCACGTTGTGGGAGAGCCCAAGGAGAAAGGGCAGCTCTATAACCTGCCAGCAGAGATCCCCTGCCCCACCTTGACACCCCCCACCCCACCCTCCCACGGCCCCACTCCAGGCAACATCTTCTTCCTGGAGACTTCAGACCGGACCAACCCCAACTTCCTGTTCATGTGCTCGGTGGAGTCGGCCGCCAGAACTCACCCCGAATCCCACGTGCTGGTCCTGATGAAAGGGCTTCCGGGTGGCAACGCCTCTCTGCCCCGGCACCTGGGCATCTCACTTCTGAGCTGCTTCCCGAATGTCCAGATGCTCCCGCTGGACCTGCGGGAGCTGTTCCGGGACACACCCCTGGCCGACTGGTACGCGGCCGTGCAGGGGCGCTGGGAGCCCTACCTGCTGCCCGTGCTCTCCGACGCCTCCAGGATCGCACTCATGTGGAAGTTCGGCGGCATCTACCTGGACACGGACTTCATTGTTCTCAAGAACCTGCGGAACCTGACCAACGTGCTGGGCACCCAGTCCCGCTACGTCCTCAACGGCGCGTTCCTGGCCTTCGAGCGCCGGCACGAGTTCATGGCGCTGTGCATGCGGGACTTCGTGGACCACTACAACGGCTGGATCTGGGGTCACCAGGGCCCGCAGCTGCTCACGCGGGTCTTCAAGAAGTGGTGTTCCATCCGCAGCCTGGCCGAGAGCCGCGCCTGCCGCGGCGTCACCACCCTGCCCCCTGAGGCCTTCTACCCCATCCCCTGGCAGGACTGGAAGAAGTACTTTGAGGACATCAACCCCGAGGAGCTGCCGCGGCTGCTCAGTGCCACCTATGCTGTCCACGTGTGGAACAAGAAGAGCCAGGGCACGCGGTTCGAGGCCACGTCCAGGGCACTGCTGGCCCAGCTGCATGCCCGCTACTGCCCCACGACGCACGAGGCCATGAAAATGTACTTGTGA

Length: 1062

View AllClose