null
Cusabio

AANAT Clone BC069434 pUC

(No reviews yet) Write a Review
SKU:
CSB-CL623090HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
AANAT
Gene ID:
15
Accession #:
BC069434
Vector:
pUC
$314.40

Description

AANAT Clone BC069434 pUC | Cusabio

Gene Name: AANAT

Gene ID: 15

Accession Number: BC069434

Plasmid: pUC

Sequence: ATGTCCACGCAGAGCACCCACCCCCTGAAACCTGAGGCCCCACGTCTGCCACCTGGGATCCCCGAGTCCCCGAGCTGTCAGCGGCGCCACACACTCCCTGCCAGTGAGTTTCGCTGCCTCACCCCGGAGGACGCTGTCAGCGCCTTTGAGATCGAGCGTGAAGCCTTCATCTCCGTCTTGGGCGTCTGCCCCCTGTACCTGGATGAGATCCGGCACTTCCTGACCCTATGTCCAGAGCTGTCCCTGGGCTGGTTCGAGGAGGGCTGCCTTGTGGCCTTCATCATCGGCTCGCTCTGGGACAAGGAGAGACTCATGCAGGAGTCACTGACGCTGCACAGGTCTGGGGGCCACATAGCCCACCTGCATGTGCTGGCCGTGCACCGCGCCTTCCGGCAGCAGGGCAGGGGCCCCATCCTGCTGTGGCGCTACCTGCACCACCTGGGCAGCCAGCCGGCCGTGCGCCGGGCCGCGCTCATGTGCGAGGACGCGCTGGTACCCTTCTATGAGAGGTTCAGCTTCCACGCCGTGGGCCCCTGCGCCATCACCGTGGGCTCCCTCACCTTCATGGAGCTCCACTGCTCCCTGCGGGGCCACCCCTTCCTGCGCAGGAACAGCGGCTGCTGA

Length: 624

View AllClose