null

AARS2 Clone BC131728 pUC

(No reviews yet) Write a Review
SKU:
CSB-CL711453HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
AARS2
Gene ID:
57505
Accession #:
BC131728
Vector:
pUC
€869.00
Frequently bought together:

Description

AARS2 Clone BC131728 pUC | Cusabio

Gene Name: AARS2

Gene ID: 57505

Accession Number: BC131728

Plasmid: pUC

Sequence: ATGGCAGCGTCAGTGGCAGCTGCAGCCCGGAGGCTGCGGCGGGCCATTCGAAGGTCGCCCGCATGGCGGGGCCTCAGCCATCGGCCGCTCTCATCGGAGCCCCCTGCAGCCAAGGCCTCGGCCGTGAGGGCCGCCTTTCTGAACTTCTTTCGGGACCGCCATGGCCACCGGCTGGTGCCCTCCGCTTCCGTGCGGCCCCGCGGCGACCCCAGTTTGCTTTTTGTCAATGCGGGCATGAACCAGTTCAAGCCAATCTTTCTGGGCACCGTGGATCCACGAAGCGAGATGGCAGGCTTCCGACGTGTGGCCAACAGCCAGAAATGTGTGAGAGCTGGAGGACACCATAACGACCTGGAAGATGTGGGTCGAGACCTTTCCCATCATACCTTCTTTGAAATGCTTGGCAATTGGGCCTTTGGGGGTGAATATTTTAAGGAGGAGGCTTGTAACATGGCCTGGGAACTGCTGACTCAGGTCTATGGGATCCCTGAGGAAAGGCTCTGGATCTCCTACTTTGATGGTGACCCCAAGGCAGGGCTGGACCCAGACCTGGAGACCAGGGACATCTGGCTGAGCTTAGGGGTGCCTGCTAGCCGTGTGCTTTCCTTTGGACCACAAGAGAACTTCTGGGAGATGGGGGATACTGGCCCTTGTGGGCCCTGTACTGAGATCCACTACGACCTTGCTGGTGGGGTGGGAGCCCCCCAGCTGGTAGAGCTTTGGAACCTGGTCTTCATGCAACACAACAGAGAGGCAGATGGAAGCCTGCAGCCCCTGCCCCAGCGGCATGTGGACACAGGAATGGGCCTGGAAAGGCTGGTGGCTGTGCTGCAAGGCAAACACTCCACCTATGACACTGACCTCTTTTCCCCGCTGCTCAACGCCATACAGCAGGGCTGCAGGGCACCCCCTTACTTGGGCCGAGTAGGGGTGGCAGACGAGGGGCGCACAGACACAGCGTACCGCGTGGTGGCTGACCACATCCGCACACTCAGTGTCTGCATCTCTGATGGCGTCTTCCCTGGGATGTCAGGTCCCCCGCTGGTTCTTCGTCGGATCCTGCGTCGAGCTGTGCGTTTCTCCATGGAGATCTTAAAGGCACCACCTGGCTTCCTAGGCAGCCTGGTACCTGTAGTGGTGGAGACACTGGGAGATGCTTATCCAGAACTGCAAAGGAACTCAGCCCAGATCGCCAACCTGGTGTCAGAGGACGAGGCAGCCTTCCTGGCCTCCCTGGAGCGGGGTAGGCGGATCATTGATCGGACTCTGAGGACCCTGGGGCCTTCAGATATGTTCCCTGCTGAAGTGGCCTGGTCCTTGTCACTGTGTGGAGACCTGGGACTCCCCTTGGACATGGTAGAGCTGATGCTGGAGGAGAAAGGGGTCCAGCTAGACTCCGCTGGACTGGAGCGGTTGGCCCAAGAGGAGGCCCAGCACCGGGCACGGCAGGCTGAGCCAGTTCAGAAGCAGGGATTGTGGCTTGATGTCCATGCGCTTGGGGAGCTGCAGCGCCAAGGAGTGCCCCCAACTGACGACAGCCCCAAGTACAACTACTCCCTGCGACCCAGCGGAAGTTATGAGTTCGGCACCTGTGAGGCCCAGGTGTTGCAACTGTATACAGAGGACGGGACAGCAGTGGCCTCCGTGGGGAAAGGCCAGCGCTGTGGCCTCCTCTTGGACAGGACCAACTTCTACGCAGAACAGGGGGGCCAGGCTTCAGACCGTGGCTACCTGGTGCGGGCAGGGCAAGAGGACGTGCTGTTCCCAGTAGCCCGGGCCCAGGTCTGTGGAGGTTTCATCCTGCATGAGGCAGTAGCCCCTGAGTGCCTGCGGTTAGGGGACCAGGTGCAGCTGCATGTGGATGAGGCCTGGCGTCTAGGCTGCATGGCGAAGCATACGGCCACCCACCTGCTGAACTGGGCACTGAGGCAGACCCTGGGCCCTGGCACAGAGCAGCAGGGCTCCCATCTCAATCCTGAGCAGCTGCGCTTGGATGTGACCACCCAGACCCCATTGACCCCAGAGCAGCTCCGGGCAGTGGAGAACACTGTGCAGGAGGCCGTGGGGCAGGATGAGGCTGTGTACATGGAGGAGGTGCCCCTGGCGCTCACTGCCCAGGTCCCTGGCCTGCGCTCTCTGGATGAGGTTTACCCAGACCCTGTGCGGGTGGTATCAGTGGGGGTGCCCGTGGCCCATGCATTGGACCCAGCCTCCCAAGCCGCACTGCAGACCTCTGTGGAGCTATGCTGTGGGACGCACCTGTTACGTACTGGGGCTGTAGGGGACCTGGTTATCATCGGGGACCGCCAGCTTTCCAAGGGCACTACCCGCCTGCTGGCCGTCACTGGGGAGCAGGCCCAGCAGGCCCGAGAGCTAGGCCAGAGCCTGGCCCAGGAAGTGAAAGCGGCCACTGAGCGGCTGAGTCTGGGGAGCCGGGATGTGGCGGAGGCACTGAGGCTGTCCAAGGACATAGGACGACTCATTGAAGCTGTGGAAACTGCTGTGATGCCCCAGTGGCAGCGGCGGGAGCTGCTGGCCACAGTGAAGATGCTGCAGCGGCGTGCCAACACTGCCATCCGTAAGCTGCAAATGGGACAGGCTGCAAAAAAAACTCAGGAGCTGCTGGAGCGGCACTCGAAGGGGCCTCTGATTGTGGACACAGTCTCTGCTGAGTCTCTCTCAGTGCTGGTGAAGGTGGTACGGCAGCTGTGTGAGCAGGCCCCCAGCACGTCTGTGCTCCTACTCAGCCCCCAGCCCATGGGGAAGGTGCTGTGTGCCTGTCAGGTGGCCCAGGGTGCCATGCCCACCTTCACAGCAGAGGCCTGGGCACTGGCAGTGTGCAGCCACATGGGGGGCAAGGCGTGGGGCTCGCGAGTGGTGGCCCAAGGCACCGGAAGCACTACTGACCTGGAAGCTGCCCTCAGTATAGCCCAAACCTATGCCCTCAGCCAGCTCTGA

Length: 2958

View AllClose