null

AASDH Clone BC141824 pUC

(No reviews yet) Write a Review
SKU:
CSB-CL680003HU2
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
AASDH
Gene ID:
132949
Accession #:
BC141824
Vector:
pUC
€756.00
Frequently bought together:

Description

AASDH Clone BC141824 pUC | Cusabio

Gene Name: AASDH

Gene ID: 132949

Accession Number: BC141824

Plasmid: pUC

Sequence: ATGACTCTTCAGGAATTGGTGCATAAGGCTGCCTCCTGTTATATGGACAGAGTAGCTGTATGTTTTGATGAATGCAACAACCAGCTTCCAGTTTACTACACCTACAAGACTGTGGTTAATGCTGCTTCTGAATTATCAAATTTTCTGCTGTTACACTGTGACTTTCAAGGAATTCGGGAAATTGGTCTCTACTGCCAACCTGGGATAGACTTACCCTCTTGGATTTTAGGAATTCTCCAAGTCCCGGCTGCTTATGTACCTATCGAGCCAGATTCACCACCGTCATTATCAACTCATTTTATGAAAAAATGTAATCTAAAGTATATCCTTGTTGAAAAAAAACAAATTAATAAATTTAAATCTTTTCATGAAACATTATTGAACTATGATACATTTACAGTGGAACATAATGACCTAGTGCTCTTCAGACTTCACTGGAAAAATACTGAGGTGAACTTGATGCTAAATGATGGAAAAGAGAAATATGAAAAAGAAAAAAGAAAAAGCATAAGTTCTGAGCATGTCAATGAAGAAAAAGCAGAAGAACACATGGATCTGAGGCTAAAGCATTGCTTAGCCTATGTTCTACATACATCAGGGACTACAGGGATACCGAAGATTGTCAGAGTGCCTCATAAGTGTATAGTACCAAATATCCAGCATTTTCGGGTACTTTTTGACATCACACAAGAAGATGTTTTGTTTCTGGCTTCACCTCTGACCTTCGATCCTTCTGTTGTGGAAATATTTCTTGCTCTATCAAGTGGTGCCTCTCTGCTTATTGTACCAACTTCTGTCAAGTTGCTCCCATCAAAATTAGCCAGCGTTCTCTTTTCCCATCATAGAGTGACTGTTTTGCAGGCAACACCAACATTGCTTAGAAGATTTGGATCTCAGCTTATCAAGTCAACTGTTTTGTCAGCCACTACTTCTCTTCGAGTATTAGCCCTTGGTGGTGAAGCGTTTCCATCATTGACAGTTCTCAGAAGCTGGAGAGGAGAAGGCAATAAAACACAAATATTTAATGTTTATGGTATCACAGAGGTATCAAGTTGGGCGACCATTTATAGGATTCCAGAGAAGACTCTTAACTCTACTCTCAAATGTGAATTGCCTGTACAACTGGGATTTCCACTTCTTGGAACAGTAGTTGAAGTCAGAGATACTAATGGCTTCACAATTCAGGAAGGCAGTGGCCAAGTATTTTTAGGTGGCAGAAACAGAGTGTGTTTTCTTGATGATGAAGTGACAGTACCACTTGGCACAATGCGAGCTACAGGAGACTTTGTGACTGTGAAAGATGGAGAGATTTTTTTTTTGGGACGAAAAGACAGTCAGATCAAACGTCATGGCAAACGTCTTAACATTGAACTTGTGCAACAGGTTGCTGAAGAGCTTCAGCAAGTGGAGTCTTGTGCAGTTACATGGTATAATCAGGAAAAATTAATTCTCTTCATGGTGTCTAAAGATGCTTCAGTAAAAGAATACATCTTTAAAGAACTGCAGAAATATCTTCCAAGTCATGCAGTCCCGGATGAGCTTGTATTGATCGATTCTCTACCATTTACATCCCACGGCAAAATTGATGTTTCTGAGTTAAACAAGATATATTTAAACTACATAAACTTGAAGTCTGAGAATAAGCTCAGTGGGAAAGAGGACCTTTGGGAAAAATTACAGTATTTGTGGAAGTCTACTCTGAATCTCCCAGAAGATCTTTTGAGGGTTCCTGATGAGTCACTCTTCTTAAATAGTGGTGGAGATTCCTTAAAGTCCATCCGGCTCCTCAGTGAGATTGAAAAACTTGTTGGTACATCAGTACCTGGGCTTCTGGAAATTATTCTCAGCAGTTCCATTTTAGAGATTTATAATCACATCCTTCAAACAGTGGTTCCAGATGAAGATGTGACATTCAGGAAGAGTTGTGCCACAAAAAGGAAACTCAGCGACATTAATCAAGAGGAAGCCAGTGGAACATCTTTACATCAGAAAGCCATCATGACTTTCACTTGCCACAATGAGATTAATGCTTTTGTTGTACTGAGCAGAGGGAGTCAAATTTTGTCTCTGAATTCCACTAGGTTTTTAACAAAGTTAGGACATTGCTCTTCAGCCTGTCCTTCTGACTCAGTTTCACAGACCAACATTCAAAATTTGAAAGGCTTAAATTCTCCAGTTCTTATTGGGAAGTCAAAAGATCCATCCTGTGTTGCAAAAGTTTCTGAAGAGGGGAAACCTGTGATAGGGACTCAGAAAATGGAGTTACATGTGAGGTGGAGGTCAGACACAGGCAAATGTGTAGATGCTTCACCGCTGGTTGTAATACCCACTTTTGATAAGTCATCTACAACTGTGTACATTGGTTCCCATTCTCATAGAATGAAGGCAGTTGACTTTTACTCTGGGAAGGTAAAATGGGAACAGATTTTGGGAGATCGAATTGAATCCTCAGCATGTGTATCTAAGTGTGGAAACTTTATTGTGGTGGGTAAGTTTTTGAATTTGAGGTTTGTGGAGTTAAATTGA

Length: 2526

View AllClose