null

ABAT Clone BC015628 pUC

(No reviews yet) Write a Review
SKU:
CSB-CL001032HU3
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ABAT
Gene ID:
18
Accession #:
BC015628
Vector:
pUC
€347.00
Frequently bought together:

Description

ABAT Clone BC015628 pUC | Cusabio

Gene Name: ABAT

Gene ID: 18

Accession Number: BC015628

Plasmid: pUC

Sequence: ATGGCCTCCATGTTGCTCGCCCAGCGCCTGGCCTGCAGCTTCCAGCACAGCTACCGCCTGCTGGTGCCTGGATCCAGACACATTAGTCAAGCTGCAGCCAAAGTCGACGTTGAATTTGATTATGATGGGCCTCTGATGAAGACGGAAGTCCCAGGGCCTAGATCTCAGGAGTTAATGAAACAGCTGAATATAATTCAGAATGCAGAGGCTGTGCATTTTTTCTGCAATTACGAAGAGAGCCGAGGCAATTACCTGGTTGATGTGGACGGCAACCGAATGCTGGATCTTTATTCCCAGATCTCCTCTGTCCCCATAGGTTACAGCCACCCCGCCCTGCTGAAACTCATCCAACAGCCTCAAAATGCGAGCATGTTTGTCAACAGACCCGCCCTCGGAATCCTGCCTCCGGAGAACTTTGTGGAGAAGCTCCGGCAGTCCTTGCTCTCGGTGGCTCCCAAAGGGATGTCCCAGCTCATCACCATGGCCTGCGGCTCCTGCTCCAATGAAAACGCCTTAAAGACCATCTTCATGTGGTACCGGAGCAAGGAAAGAGGGCAGAGGGGCTTCTCCCAGGAGGAGCTGGAGACGTGCATGATTAACCAGGCCCCTGGCTGCCCCGACTACAGCATCCTCTCCTTCATGGGCGCGTTCCATGGGAGGACCATGGGTTGCTTAGCGACCACGCACTCTAAAGCCATTCACAAGATCGACATCCCTTCCTTTGACTGGCCCATCGCACCGTTCCCACGGCTGAAATACCCTCTGGAAGAGTTTGTGAAAGAGAACCAACAGGAGGAGGCCCGCTGTCTGGAAGAGGTGGAGGATCTGATTGTGAAATATCGGAAAAAGAAGAAGACGGTGGCCGGGATCATCGTGGAGCCCATCCAGTCCGAGGGTGGAGACAACCACGCATCCGATGACTTCTTTCGGAAGCTGAGAGACATCGCCAGGAAGCATGGCTGCGCCTTCTTGGTGGACGAGGTCCAGACCGGAGGAGGCTGCACGGGCAAGTTCTGGGCCCATGAGCACTGGGGCCTGGATGACCCAGCAGACGTGATGACCTTCAGCAAGAAGATGATGACTGGGGGCTTCTTCCACAAGGAGGAGTTCAGGCCTAATGCTCCCTACCGGATCTTCAACACCTGGCTGGGGGACCCGTCCAAGAACCTGTTGCTGGCTGAGGTCATCAACATCATCAAGCGGGAGGACCTGCTAAATAATGCAGCCCATGCCGGGAAGGCCCTGCTCACAGGACTGCTGGACCTCCAGGCCCGGTACCCCCAGTTCATCAGCAGGGTGAGAGGACGAGGCACCTTTTGCTCCTTCGATACTCCCGATGATTCCATACGGAATAAGCTCATTTTAATTGCCAGAAACAAAGGTGTGGTGTTGGGTGGCTGTGGTGACAAATCCATTCGTTTCCGTCCCACGCTGGTCTTCAGGGATCACCACGCTCACCTGTTCCTCAATATTTTCAGTGACATCTTAGCAGACTTCAAGTAA

Length: 1503

View AllClose