null

ABCA1 Clone BC141816 pUC

(No reviews yet) Write a Review
SKU:
CSB-CL001033HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ABCA1
Gene ID:
19
Accession #:
BC141816
Vector:
pUC
€313.00
Frequently bought together:

Description

ABCA1 Clone BC141816 pUC | Cusabio

Gene Name: ABCA1

Gene ID: 19

Accession Number: BC141816

Plasmid: pUC

Sequence: ATGGCTTGTTGGCCTCAGCTGAGGTTGCTGCTGTGGAAGAACCTCACTTTCAGAAGAAGACAAACATGTCAGCTGCTGCTGGAAGTGGCCTGGCCTCTATTTATCTTCCTGATCCTGATCTCTGTTCGGCTGAGCTACCCACCCTATGAACAACATGAATGCCATTTTCCAAATAAAGCCATGCCCTCTGCAGGAACACTTCCTTGGGTTCAGGGGATTATCTGTAATGCCAACAACCCCTGTTTCCGTTACCCGACTCCTGGGGAGGCTCCCGGAGTTGTTGGAAACTTTAACAAATCCATTGTGGCTCGCCTGTTCTCAGATGCTCGGAGGCTTCTTTTATACAGCCAGAAAGACACCAGCATGAAGGACATGCGCAAAGTTCTGAGAACATTACAGCAGATCAAGAAATCCAGCTCAAACTTGAAGCTTCAAGATTTCCTGGTGGACAATGAAACCTTCTCTGGGTTCCTATATCACAACCTCTCTCTCCCAAAGTCTACTGTGGACAAGATGCTGAGGGCTGATGTCATTCTCCACAAGGTATTTTTGCAAGGCTACCAGTTACATTTGACAAGTCTGTGCAATGGATCAAAATCAGAAGAGATGATTCAACTTGGTGACCAAGAAGTTTCTGAGCTTTGTGGCCTACCAAAGGAGAAACTGGCTGCAGCAGAGCGAGTACTTCGTTCCAACATGGACATCCTGAAGCCAATCCTGAGAACACTAAACTCTACATCTCCCTTCCCGAGCAAGGAGCTGGCTGAAGCCACAAAAACATTGCTGCATAGTCTTGGGACTCTGGCCCAGGAGATGTGA

Length: 819

View AllClose