null

ABCB8 Clone BC141814 pUC

(No reviews yet) Write a Review
SKU:
CSB-CL868325HU1
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ABCB8
Gene ID:
11194
Accession #:
BC141814
Vector:
pUC
€660.00
Frequently bought together:

Description

ABCB8 Clone BC141814 pUC | Cusabio

Gene Name: ABCB8

Gene ID: 11194

Accession Number: BC141814

Plasmid: pUC

Sequence: ATGCTGGTGCATTTATTTCGGGTCGGGATTCGGGGTGGCCCATTCCCAGGCAGGCTGCTACCGCCCCTCCGCTTCCAGACATTCTCAGCTGTCAGGTACTCTGATGGCTACCGCAGCTCCTCCCTCCTCCGGGCCGTGGCCCACCTGCGGTCCCAGCTCTGGGCCCACCTCCCTCGAGCCCCCCTAGCTCCCAGATGGAGCCCCTCTGCCTGGTGCTGGGTTGGGGGAGCCCTGCTAGGCCCCATGGTACTGAGTAAGCATCCCCACCTCTGCCTTGTGGCCCTGTGTGAGGCAGAAGAGGCCCCTCCTGCCAGCTCCACACCCCATGTCGTGGGGTCTCGCTTTAACTGGAAGCTCTTCTGGCAGTTTCTGCACCCCCACCTGCTGGTCCTGGGGGTAGCCGTCGTGCTGGCCTTGGGTGCGGCACTCGTGAATGTACAGATCCCCCTGCTCCTGGGCCAGCTGGTAGAGGTCGTGGCCAAGTACACAAGGGACCACGTAGGGAGTTTCATGACTGAGTCCCAGAATCTCAGCACCCACCTGCTTATCCTCTATGGTGTCCAGGGACTGCTGACCTTCGGGTACCTGGTGCTGCTGTCCCACGTTGGCGAGCGCATGGCTGTGGACATGCGGAGGGCCCTCTTCAGCTCCCTGCTCCGACAAGACATCACCTTCTTTGACGCCAATAAGACAGGGCAGCTGGTGAGCCGCTTGACAACTGACGTGCAGGAGTTTAAGTCATCCTTCAAGCTTGTCATCTCCCAGGGGCTGCGAAGCTGCACCCAGGTGGCAGGCTGCCTGGTGTCCCTGTCCATGCTGTCGACACGCCTCACGCTGCTGCTGATGGTGGCCACACCAGCCCTGATGGGAGTGGGCACCCTGATGGGCTCAGGCCTCCGAAAATTGTCTCGCCAGTGTCAGGAGCAGATCGCCAGGGCAATGGGCGTAGCAGACGAGGCCCTGGGCAATGTGCGGACTGTGCGTGCCTTCGCCATGGAGCAACGGGAAGAGGAGCGCTATGGGGCAGAGCTGGAAGCCTGCCGCTGCCGGGCAGAGGAGCTGGGCCGCGGCATCGCCTTGTTCCAAGGGCTTTCCAACATCGCCTTCAACTGCATGGTCTTGGGTACCCTATTTATTGGGGGCTCCCTTGTGGCCGGACAGCAGCTGACAGGGGGAGACCTCATGTCCTTCCTGGTGGCCTCCCAGACAGTGCAAAGGTCCATGGCCAACCTCTCTGTCCTGTTTGGGCAGGTGGTCCGGGGGCTGAGTGCAGGTGCCCGGGTCTTTGAGTACATGGCCCTGAACCCCTGCATCCCACTGTCTGGGGGCTGCTGCGTCCCCAAAGAGCAGCTGCGTGGCTCCGTTACATTTCAGAACGTCTGCTTCAGCTACCCCTGCCGCCCCGGCTTCGAGGTGCTGAAAGACTTCACCCTGACGCTGCCCCCTGGCAAGATCGTGGCCCTCGTGGGCCAGTCTGGCGGAGGAAAGACCACCGTGGCTTCCCTGCTGGAGCGCTTCTACGACCCCACGGCAGGCGTGGTGATGCTGGATGGGCGGGACCTGCGCACCCTTGACCCCTCCTGGCTCCGGGGCCAGGTTGTCGGCTTCATCAGCCAGGAGCCCGTCCTGTTTGGGACGACCATCATGGAAAACATCCGCTTTGGGAAGCTGGAAGCTTCCGATGAAGAGGTGTACACAGCCGCCCGGGAAGCGAATGCTCACGAGTTCATCACCAGCTTCCCCGAGGGCTACAACACGGTCGTCGGTGAACGGGGCACTACCCTGTCTGGGGGCCAGAAGCAGCGCCTGGCCATCGCCCGAGCCCTTATCAAGCAGCCCACGGTGCTGATACTGGATGAAGCTACCAGCGCGCTGGATGCAGAGTCCGAGCGGGTTGTACAGGAGGCCCTGGACCGGGCCAGTGCAGGCCGCACGGTGCTGGTAATTGCCCACCGGCTCAGCACTGTCCGTGGGGCCCACTGCATTGTCGTCATGGCCGATGGCCGTGTCTGGGAGGCTGGGACACATGAAGAGCTCCTGAAGAAAGGCGGGCTATACGCCGAGCTCATCCGGAGGCAGGCCCTGGATGCCCCGAGGACAGCGGCCCCACCGCCCAAAAAGCCAGAAGGCCCCAGGAGCCACCAGCACAAGTCCTGA

Length: 2157

View AllClose