null

ABHD1 Clone BC039576 pUC

(No reviews yet) Write a Review
SKU:
CSB-CL842760HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ABHD1
Gene ID:
84696
Accession #:
BC039576
Vector:
pUC
€417.00
Frequently bought together:

Description

ABHD1 Clone BC039576 pUC | Cusabio

Gene Name: ABHD1

Gene ID: 84696

Accession Number: BC039576

Plasmid: pUC

Sequence: ATGCTGAGCTCCTTCCTGAGCCCCCAGAATGGCACCTGGGCAGACACCTTCTCTCTGCTCTTGGCTCTTGCCGTTGCCCTCTACTTGGGCTACTACTGGGCATGTGTGCTTCAGAGGCCTCGGCTGGTGGCTGGGCCGCAGTTTCTGGCCTTCCTGGAGCCACACTGTTCCATCACCACCGAGACTTTCTACCCAACGCTGTGGTGTTTTGAGGGGCGACTACAAAGCATCTTCCAAGTCCTCCTGCAGTCTCAGCCCCTAGTCCTTTATCAGAGTGACATCCTCCAAACACCAGATGGAGGCCAGCTCCTGCTAGACTGGGCCAAGCAGCCTGACAGCAGCCAAGACCCTGATCCTACTACCCAGCCCATTGTGCTGCTGCTTCCTGGCATCACTGGCAGTAGCCAGGAGACATACGTCTTGCACCTAGTTAACCAAGCTCTGAGGGATGGCTACCAGGCTGTCGTGTTTAACAACCGGGGCTGCCGTGGGGAGGAACTGCGGACCCACAGGGCTTTTTGTGCCAGCAATACTGAAGATCTAGAGACAGTCGTGAACCACATAAAGCATCGTTATCCCCAAGCTCCACTGCTGGCCGTGGGCATCTCTTTTGGAGGGATACTGGTGCTGAATCACCTGGCACAGGCCAGGCAGGCTGCAGGGCTGGTGGCAGCACTGACTCTGTCTGCATGCTGGGATTCCTTTGAGACCACTCGCTCCCTGGAAACCCCACTCAACTCACTGCTCTTCAATCAGCCCCTCACTGCTGGGCTCTGCCAACTTGTGGAACGAAACAGAAAGGTGATTGAAAAGGTGGTGGACATAGACTTTGTACTACAGGCCCGTACAATCCGCCAGTTTGATGAGCGCTACACATCTGTGGCCTTTGGATATCAAGACTGTGTTACCTACTACAAAGCAGCAAGCCCTAGAACCAAGATAGATGCCATCCGGATCCCTGTGCTCTATCTCAGTGCAGCAGATGACCCCTTCTCCCCCGTCTGTGCCCTTCCCATACAGGCCGCCCAACACTCCCCCTACGTTGCGCTGCTCATCACAGCCCGGGGTGGCCACATCGGCTTCCTGGAAGGGCTGCTCCCGTGGCAGCACTGGTACATGAGCCGCCTCTTGCATCAGTACGCCAAAGCCATCTTCCAGGACCCAGAGGGGCTGCCTGACCTCAGGGCTCTCTTACCTTCTGAGGACAGAAACAGCTGA

Length: 1218

View AllClose