null

ACADS Clone BC025963 pUC

(No reviews yet) Write a Review
SKU:
CSB-CL001127HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ACADS
Gene ID:
35
Accession #:
BC025963
Vector:
pUC
€422.00
Frequently bought together:

Description

ACADS Clone BC025963 pUC | Cusabio

Gene Name: ACADS

Gene ID: 35

Accession Number: BC025963

Plasmid: pUC

Sequence: ATGGCCGCCGCGCTGCTCGCCCGGGCCTCGGGCCCTGCCCGCAGAGCTCTCTGTCCTAGGGCCTGGCGGCAGTTACACACCATCTACCAGTCTGTGGAACTGCCCGAGACACACCAGATGTTGCTCCAGACATGCCGGGACTTTGCCGAGAAGGAGTTGTTTCCCATTGCAGCCCAGGTGGATAAGGAACATCTCTTCCCAGCGGCTCAGGTGAAGAAGATGGGCGGGCTTGGGCTTCTGGCCATGGACGTGCCCGAGGAGCTTGGCGGTGCTGGCCTCGATTACCTGGCCTACGCCATCGCCATGGAGGAGATCAGCCGCGGCTGCGCCTCCACCGGAGTCATCATGAGTGTCAACAACTCTCTCTACCTGGGGCCCATCTTGAAGTTTGGCTCCAAGGAGCAGAAGCAGGCGTGGGTCACGCCTTTCACCAGTGGTGACAAAATTGGCTGCTTTGCCCTCAGCGAACCAGGGAACGGCAGTGATGCAGGAGCTGCGTCCACCACCGCCCGGGCCGAGGGCGACTCATGGGTTCTGAATGGAACCAAAGCCTGGATCACCAATGCCTGGGAGGCTTCGGCTGCCGTGGTCTTTGCCAGCACGGACAGAGCCCTGCAAAACAAGAGCATCAGTGCCTTCCTGGTCCCCATGCCAACGCCTGGGCTCACGTTGGGGAAGAAAGAAGACAAGCTGGGCATCCGGGGCTCATCCACGGCCAACCTCATCTTTGAGGACTGTCGCATCCCCAAGGACAGCATCCTGGGGGAGCCAGGGATGGGCTTCAAGATAGCCATGCAAACCCTGGACATGGGCCGCATCGGCATCGCCTCCCAGGCCCTGGGCATTGCCCAGACCGCCCTCGATTGTGCTGTGAACTACGCTGAGAATCGCATGGCCTTCGGGGCGCCCCTCACCAAGCTCCAGGTCATCCAGTTCAAGTTGGCAGACATGGCCCTGGCCCTGGAGAGTGCCCGGCTGCTGACCTGGCGTGCTGCCATGCTGAAGGATAACAAGAAGCCTTTCATCAAGGAGGCAGCCATGGCCAAGCTGGCCGCCTCGGAGGCCGCGACCGCCATCAGCCACCAGGCCATCCAGATCCTGGGCGGCATGGGCTACGTGACAGAGATGCCGGCAGAGCGGCACTACCGCGACGCCCGCATCACTGAGATCTACGAGGGCACCAGCGAAATCCAGCGGCTGGTGATCGCCGGGCATCTGCTCAGGAGCTACCGGAGCTGA

Length: 1239

View AllClose