null

ACAT2 Clone BC000408 pUC

(No reviews yet) Write a Review
SKU:
CSB-CL861152HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ACAT2
Gene ID:
39
Accession #:
BC000408
Vector:
pUC
€410.00
Frequently bought together:

Description

ACAT2 Clone BC000408 pUC | Cusabio

Gene Name: ACAT2

Gene ID: 39

Accession Number: BC000408

Plasmid: pUC

Sequence: ATGAATGCAGGCTCAGATCCTGTGGTCATCGTCTCGGCGGCGCGGACCATCATAGGTTCCTTCAATGGTGCCTTAGCTGCTGTTCCTGTCCAGGACCTGGGCTCCACTGTCATCAAAGAAGTCTTGAAGAGGGCCACTGTGGCTCCGGAAGATGTGTCTGAGGTCATCTTTGGACATGTCTTGGCAGCAGGCTGTGGGCAGAATCCTGTTAGACAAGCCAGTGTGGGTGCAGGAATTCCCTACTCTGTTCCAGCATGGAGCTGCCAGATGATCTGTGGGTCAGGCCTAAAAGCTGTGTGCCTTGCAGTCCAGTCAATAGGGATAGGAGACTCCAGCATTGTGGTTGCAGGAGGCATGGAAAATATGAGCAAGGCTCCTCACTTGGCTTACTTGAGAACAGGAGTAAAGATAGGTGAGATGCCACTGACTGACAGTATACTCTGTGATGGTCTTACAGATGCATTTCACAACTGTCATATGGGTATTACAGCTGAAAATGTAGCCAAAAAATGGCAAGTGAGTAGAGAAGATCAGGACAAGGTTGCAGTTCTGTCCCAGAACAGGACAGAGAATGCACAGAAAGCTGGCCATTTTGACAAAGAGATTGTACCAGTTTTGGTGTCAACTAGAAGAGGTCTTATTGAAGTTAAAACAGATGAGTTTCCTCGCCATGGGAGCAACATAGAAGCCATGTCCAAGCTAAAGCCTTACTTTCTTACTGATGGAACGGGAACAGTCACCCCAGCCAATGCTTCAGGAATAAATGATGGTGCTGCAGCTGTCGTTCTTATGAAGAAGTCAGAAGCTGATAAACGTGGACTTACACCTTTAGCACGGATAGTTTCCTGGTCCCAAGTGGGTGTGGAGCCTTCCATTATGGGAATAGGACCAATTCCAGCCATAAAGCAAGCTGTTACAAAAGCAGGTTGGTCACTGGAAGATGTTGACATATTTGAAATCAATGAAGCCTTTGCAGCTGTCTCTGCTGCAATAGTTAAAGAACTTGGATTAAACCCAGAGAAGGTCAATATTGAAGGAGGGGCTATAGCCTTGGGCCACCCTCTTGGAGCATCTGGCTGTCGAATTCTTGTGACCCTGTTACACACACTGGAGAGAATGGGCAGAAGTCGTGGTGTTGCAGCCCTGTGCATTGGGGGTGGGATGGGAATAGCAATGTGTGTTCAGAGAGAATGA

Length: 1194

View AllClose