null

ACD Clone BC016904 pUC

(No reviews yet) Write a Review
SKU:
CSB-CL839289HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ACD
Gene ID:
65057
Accession #:
BC016904
Vector:
pUC
€525.00
Frequently bought together:

Description

ACD Clone BC016904 pUC | Cusabio

Gene Name: ACD

Gene ID: 65057

Accession Number: BC016904

Plasmid: pUC

Sequence: ATGCCTGGCCGCTGTCAGAGTGACGCCGCGATGAGAGTAAACGGGCCAGCATCCCGTGCACCAGCGGGGTGGACCAGCGGGAGTCTGCACACAGGCCCCCGAGCAGGACGCCCTCGTGCGCAGGCGCGGGGTGTACGTGGGCGGGGCCTCCTCCTCCGGCCCCGCCCAGCGAAGGAGCTTCCTCTTCCGAGGAAAGGCGGGGCCTGGGCGCCCGCGGGAAACCCGGGCCCGTTGCATCCGCTGGGTGTAGCCGTGGGGATGGCAGGTTCGGGGAGGCTGGTCCTACGGCCCTGGATTCGGGAGCTGATTCTGGGGTCAGAGACACCCTCCAGTCCACGAGCCGGGCAGCTGCTTGAGGTACTACAGGACGCCGAGGCCGCGGTCGCGGGCCCATCCCACGCCCCTGATACGTCCGACGTCGGGGCCACGCTGCTTGTGTCTGACGGGACCCACAGTGTCCGATGCCTGGTGACGCGGGAGGCCCTGGACACCTCGGACTGGGAGGAGAAGGAGTTCGGCTTCCGCGGGACAGAGGGCCGGCTGCTGCTGCTGCAGGACTGCGGGGTTCATGTCCAGGTCGCTGAGGGCGGCGCGCCCGCAGAGTTCTATCTCCAGGTGGACCGCTTCAGCCTGCTGCCCACGGAGCAGCCCCGGCTACGGGTGCCTGGTTGCAACCAAGACTTAGATGTTCAGAAAAAGCTCTATGACTGCCTTGAGGAGCACCTTTCAGAGTCCACCTCGTCCAATGCAGGCCTATCACTGTCCCAGCTTCTGGATGAAATGCGGGAGGACCAGGAGCATCAGGGGGCACTCGTGTGCCTGGCTGAAAGCTGCCTGACACTGGAGGGCCCTTGCACAGCACCCCCTGTCACCCACTGGGCTGCCTCACGATGCAAGGCCACGGGAGAAGCTGTGTACACTGTCCCCAGCTCAATGCTGTGCATCTCTGAGAATGACCAGCTAATTCTGAGCTCTCTAGGCCCCTGTCAGAGGACACAGGGCCCTGAGCTGCCCCCACCAGACCCGGCTCTGCAGGACCTATCTCTGACCCTCATAGCCTCTCCTCCTTCCTCACCCAGTTCCTCAGGAACCCCGGCCTTACCCGGCCACATGTCATCCGAGGAAAGTGGTACCAGCATCAGCCTTCTGCCTGCCCTGTCCTTGGCTGCTCCAGACCCAGGGCAGAGAAGCAGCTCCCAGCCCTCACCAGCCATCTGCTCAGCCCCTGCCACCCTGACCCCCAGGTCCCCACACGCCAGCCGTACCCCCAGCTCCCCACTCCAGAGCTGCACTCCCAGTCTCTCACCCCGTAGCCATGTCCCCAGTCCACACCAGGCTCTTGTGACCAGGCCCCAGAAACCTAGCCTGGAGTTCAAGGAGTTTGTAGGGTTGCCCTGCAAGAATCGGCCGCCTTTTCCCAGGACCGGAGCTACCAGGGGAGCCCAGGAGCCCTGCTCTGTCTGGGAACCCCCAAAGAGGCATCGTGATGGTTCTGCCTTCCAGTATGAGTATGAGCCACCCTGCACGTCCCTCTGTGCTCGGGTCCAAGCTGCCAGGCTTCCTCCCCAGCTCATGGCCTGGGCCTTGCACTTTCTGATGGATGCACAGCCAGGGTCTGAGCCAACTCCGATGTGA

Length: 1635

View AllClose