null

ACTG2 Clone BC012617 pUC

(No reviews yet) Write a Review
SKU:
CSB-CL001223HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ACTG2
Gene ID:
72
Accession #:
BC012617
Vector:
pUC
€214.00
Frequently bought together:

Description

ACTG2 Clone BC012617 pUC | Cusabio

Gene Name: ACTG2

Gene ID: 72

Accession Number: BC012617

Plasmid: pUC

Sequence: ATGTGTGAAGAGGAGACCACCGCGCTCGTGTGTGACAATGGCTCTGGCCTGTGCAAGGCAGGCTTCGCAGGAGATGATGCCCCCCGGGCTGTCTTCCCCTCCATTGTGGGCCGCCCTCGCCACCAGGGTGTGATGGTGGGAATGGGCCAGAAAGACAGCTATGTGGGGGATGAGGCTCAGAGCAAGCGAGGGATCCTAACTCTCAAATACCCCATTGAACACGGCATCATCACCAACTGGGATGACATGGAGAAGATCTGGCACCACTCCTTCTACAATGAGCTGCGTGTAGCACCTGAAGAGCACCCCACCCTGCTCACAGAGGCTCCCCTAAATCCCAAGGCCAACAGGGAGAAGATGACCCAGATCATGTTTGAAACCTTCAATGTCCCTGCCATGTACGTCGCCATTCAAGCTGTGCTCTCCCTCTATGCCTCTGGCCGCACGACAGGCATCGTCCTGGATTCAGGTGATGGCGTCACCCACAATGTCCCCATCTATGAAGGCTATGCCCTGCCCCATGCCATCATGCGCCTGGACTTGGCTGGCCGTGACCTCACGGACTACCTCATGAAGATCCTCACAGAGAGAGGCTATTCCTTTGTGACCACAGCTGAGAGAGAAATTGTGCGAGACATCAAGGAGAAGCTGTGCTATGTGGCCCTGGATTTTGAGAATGAGATGGCCACAGCAGCTTCCTCTTCCTCCCTGGAGAAGAGCTATGAGCTGCCAGATGGGCAGGTTATCACCATTGGCAATGAGCGCTTCCGCTGCCCTGAGACCCTCTTCCAGCCTTCCTTTATTGGCATGGAGTCCGCTGGAATTCATGAGACAACCTACAATTCCATCATGAAGTGTGACATTGACATCCGTAAGGACTTATATGCCAACAATGTCCTCTCTGGGGGCACCACCATGTACCCTGGCATTGCTGACAGGATGCAGAAGGAGATCACAGCCCTGGCCCCCAGCACCATGAAGATCAAGATTATTGCTCCCCCAGAGCGGAAGTACTCAGTCTGGATCGGGGGCTCTATCCTGGCCTCTCTCTCCACCTTCCAGCAGATGTGGATCAGCAAGCCTGAGTATGATGAGGCAGGGCCCTCCATTGTCCACAGGAAGTGCTTCTAA

Length: 1131

View AllClose