null
Cusabio

ADAM9 Clone BC126406 pUC

(No reviews yet) Write a Review
SKU:
CSB-CL618774HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ADAM9
Gene ID:
8754
Accession #:
BC126406
Vector:
pUC
$525.60

Description

ADAM9 Clone BC126406 pUC | Cusabio

Gene Name: ADAM9

Gene ID: 8754

Accession Number: BC126406

Plasmid: pUC

Sequence: ATGGGGTCTGGCGCGCGCTTTCCCTCGGGGACCCTTCGTGTCCGGTGGTTGCTGTTGCTTGGCCTGGTGGGCCCAGTCCTCGGTGCGGCGCGGCCAGGCTTTCAACAGACCTCACATCTTTCTTCTTATGAAATTATAACTCCTTGGAGATTAACTAGAGAAAGAAGAGAAGCCCCTAGGCCCTATTCAAAACAAGTATCTTATGTTATTCAGGCTGAAGGAAAAGAGCATATTATTCACTTGGAAAGGAACAAAGACCTTTTGCCTGAAGATTTTGTGGTTTATACTTACAACAAGGAAGGGACTTTAATCACTGACCATCCCAATATACAGAATCATTGTCATTATCGGGGCTATGTGGAGGGAGTTCATAATTCATCCATTGCTCTTAGCGACTGTTTTGGACTCAGAGGATTGCTGCATTTAGAGAATGCGAGTTATGGGATTGAACCCCTGCAGAACAGCTCTCATTTTGAGCACATCATTTATCGAATGGATGATGTCTACAAAGAGCCTCTGAAATGTGGAGTTTCCAACAAGGATATAGAGAAAGAAACTGCAAAGGATGAAGAGGAAGAGCCTCCCAGCATGACTCAGCTACTTCGAAGAAGAAGAGCTGTCTTGCCACAGACCCGGTATGTGGAGCTGTTCATTGTCGTAGACAAGGAAAGGTATGACATGATGGGAAGAAATCAGACTGCTGTGAGAGAAGAGATGATTCTCCTGGCAAACTACTTGGATAGTATGTATATTATGTTAAATATTCGAATTGTGCTAGTTGGACTGGAGATTTGGACCAATGGAAACCTGATCAACATAGTTGGGGGTGCTGGTGATGTGCTGGGGAACTTCGTGCAGTGGCGGGAAAAGTTTCTTATCACACGTCGGAGACATGACAGTGCACAGCTAGTTCTAAAGAAAGGTTTTGGTGGAACTGCAGGAATGGCATTTGTGGGAACAGTGTGTTCAAGGAGCCACGCAGGCGGGATTAATGTGTTTGGACAAATCACTGTGGAGACATTTGCTTCCATTGTTGCTCATGAATTGGGTCATAATCTTGGAATGAATCACGATGATGGGAGAGATTGTTCCTGTGGAGCAAAGAGCTGCATCATGAATTCAGGAGCATCGGGTTCCAGAAACTTTAGCAGTTGCAGTGCAGAGGACTTTGAGAAGTTAACTTTAAATAAAGGAGGAAACTGCCTTCTTAATATTCCAAAGCCTGATGAAGCCTATAGTGCTCCCTCCTGTGGTAATAAGTTGGTGGACGCTGGGGAAGAGTGTGACTGTGGTACTCCAAAGGAATGTGAATTGGACCCTTGCTGCGAAGGAAGTACCTGTAAGCTTAAATCATTTGCTGAGTGTGCATATGGTGACTGTTGTAAAGACTGTCGGTTCCTTCCAGGAGGTACTTTATGCCGAGGAAAAACCAGTGAGTGTGATGTTCCAGAGTACTGCAATGGTTCTTCTCAGTTCTGTCAGCCAGATGTTTTTATTCAGAATGGATATCCTTGCCAGAATAACAAAGCCTATTGCTACAACGGCATGTGCCAGTATTATGATGCTCAATGTCAAGTCATCTTTGGCTCAAAAGCCAAGGCTGCCCCCAAAGATTGTTTCATTGAAGTGAATTCTAAAGGTGACAGATTTGGCAATTGTGGTTTCTCTGGCAATGAATACAAGAAGTGTGCCACTGGGAATGCTTTGTGTGGAAAGCTTCAGTGTGAGAATGTACAAGAGATACCTGTATTTGGAATTGTGCCTGCTATTATTCAAACGCCTAGTCGAGGCACCAAATGTTGGGGTGTGGATTTCCAGCTAGGATCAGATGTTCCAGATCCTGGGATGGTTAACGAAGGCACAAAATGTGGTGCTGGAAAGATCTGTAGAAACTTCCAGTGTGTAGATGCTTCTGTTCTGAATTATGACTGTGATGTTCAGAAAAAGTGTCATGGACATGGGGTATGTAATAGCAATAAGAATTGTCACTGTGAAAATGGCTGGGCTCCCCCAAATTGTGAGACTAAAGGATACGGAGGAAGTGTGGACAGTGGACCTACATACAATGGTCAGATGGCAAAAATCAAGCAAACCCTTCTAGACAGCCGGGGAGTGTTCCTCGACATGTTTCTCCAGTGA

Length: 2139

View AllClose