Cusabio

ADCYAP1R1 Clone BC117116 pUC

(No reviews yet) Write a Review
SKU:
CSB-CL001347HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ADCYAP1R1
Gene ID:
117
Accession #:
BC117116
Vector:
pUC
$584.40

Description

ADCYAP1R1 Clone BC117116 pUC | Cusabio

Gene Name: ADCYAP1R1

Gene ID: 117

Accession Number: BC117116

Plasmid: pUC

Sequence: ATGGCTGGTGTCGTGCACGTTTCCCTGGCTGCTCTCCTCCTGCTGCCTATGGCCCCTGCCATGCATTCTGACTGCATCTTCAAGAAGGAGCAAGCCATGTGCCTGGAGAAGATCCAGAGGGCCAATGAGCTGATGGGCTTCAATGATTCCTCTCCAGGCTGTCCTGGGATGTGGGACAACATCACGTGTTGGAAGCCCGCCCATGTGGGTGAGATGGTCCTGGTCAGCTGCCCTGAGCTCTTCCGAATCTTCAACCCAGACCAAGTCTGGGAGACCGAAACCATTGGAGAGTCTGATTTTGGTGACAGTAACTCCTTAGATCTCTCAGACATGGGAGTGGTGAGCCGGAACTGCACGGAGGATGGCTGGTCGGAACCCTTCCCTCATTACTTTGATGCCTGTGGGTTTGATGAATATGAATCTGAGACTGGGGACCAGGATTATTACTACCTGTCAGTGAAGGCCCTCTACACGGTTGGCTACAGCACATCCCTCGTCACCCTCACCACTGCCATGGTCATCCTTTGTCGCTTCCGGAAGCTGCACTGCACACGCAACTTCATCCACATGAACCTGTTTGTGTCGTTCATGCTGAGGGCGATCTCCGTCTTCATCAAAGACTGGATTCTGTATGCGGAGCAGGACAGCAACCACTGCTTCATCTCCACTGTGGAATGTAAGGCCGTCATGGTTTTCTTCCACTACTGTGTTGTGTCCAACTACTTCTGGCTGTTCATCGAGGGCCTGTACCTCTTCACTCTGCTGGTGGAGACCTTCTTCCCTGAAAGGAGATACTTCTACTGGTACACCATCATTGGCTGGGGGACCCCAACTGTGTGTGTGACAGTGTGGGCTACGCTGAGACTCTACTTTGATGACACAGGCTGCTGGGATATGAATGACAGCACAGCTCTGTGGTGGGTGATCAAAGGCCCTGTGGTTGGCTCTATCATGGTTAACTTTGTGCTTTTTATTGGCATTATCGTCATCCTTGTGCAGAAACTTCAGTCTCCAGACATGGGAGGCAATGAGTCCAGCATCTACTTCAGCTGCGTGCAGAAATGCTACTGCAAGCCACAGCGGGCTCAGCAGCACTCTTGCAAGATGTCAGAACTGTCCACCATTACTCTGCGACTGGCCCGGTCCACCCTGCTGCTCATCCCACTATTCGGAATCCACTACACAGTATTTGCCTTCTCCCCAGAGAATGTCAGCAAAAGGGAAAGACTCGTGTTTGAGCTGGGGCTGGGCTCCTTCCAGGGCTTTGTGGTGGCTGTTCTCTACTGTTTTCTGAATGGTGAGGTACAAGCGGAGATCAAGCGAAAATGGCGAAGCTGGAAGGTGAACCGTTACTTCGCTGTGGACTTCAAGCACCGACACCCGTCTCTGGCCAGCAGTGGGGTGAATGGGGGCACCCAGCTCTCCATCCTGAGCAAGAGCAGCTCCCAAATCCGCATGTCTGGCCTCCCTGCTGACAATCTGGCCACCTGA

Length: 1491

View AllClose