null

ADI1 Clone BC001467 pUC

(No reviews yet) Write a Review
SKU:
CSB-CL861145HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ADI1
Gene ID:
55256
Accession #:
BC001467
Vector:
pUC
€240.00
Frequently bought together:

Description

ADI1 Clone BC001467 pUC | Cusabio

Gene Name: ADI1

Gene ID: 55256

Accession Number: BC001467

Plasmid: pUC

Sequence: ATGGTGCAGGCCTGGTATATGGACGACGCCCCGGGCGACCCGCGGCAACCCCACCGCCCCGACCCCGGCCGCCCAGTGGGCCTGGAGCAGCTGCGGCGGCTCGGGGTGCTCTACTGGAAGCTGGATGCTGACAAATATGAGAATGATCCAGAATTAGAAAAGATCCGAAGAGAGAGGAACTACTCCTGGATGGACATCATAACCATATGCAAAGATAAACTACCAAATTATGAAGAAAAGATTAAGATGTTCTACGAGGAGCATTTGCACTTGGACGATGAGATCCGCTACATCCTGGATGGCAGTGGGTACTTCGATGTGAGGGACAAGGAGGACCAGTGGATCCGGATCTTCATGGAGAAGGGAGACATGGTGACGCTCCCCGCGGGGATCTATCACCGCTTCACGGTGGACGAGAAGAACTACACGAAGGCCATGCGGCTGTTTGTGGGAGAACCGGTGTGGACAGCGTACAACCGGCCCGCTGACCATTTTGAAGCCCGCGGGCAGTACGTGAAATTTCTGGCACAGACCGCCTAG

Length: 540

View AllClose