null
Cusabio

IL28A Clone BC113581 pUC

(No reviews yet) Write a Review
SKU:
CSB-CL816921HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
IL28A
Gene ID:
282616
Accession #:
BC113581
Vector:
pUC
€257.00

Description

IL28A Clone BC113581 pUC | Cusabio

Gene Name: IL28A

Gene ID: 282616

Accession Number: BC113581

Plasmid: pUC

Sequence: ATGAAACTAGACATGACTGGGGACTGCACGCCAGTGCTGGTGCTGATGGCCGCAGTGCTGACCGTGACTGGAGCAGTTCCTGTCGCCAGGCTCCACGGGGCTCTCCCGGATGCAAGGGGCTGCCACATAGCCCAGTTCAAGTCCCTGTCTCCACAGGAGCTGCAGGCCTTTAAGAGGGCCAAAGATGCCTTAGAAGAGTCGCTTCTGCTGAAGGACTGCAGGTGCCACTCCCGCCTCTTCCCCAGGACCTGGGACCTGAGGCAGCTGCAGGTGAGGGAGCGCCCCATGGCTTTGGAGGCTGAGCTGGCCCTGACGCTGAAGGTTCTGGAGGCCACCGCTGACACTGACCCAGCCCTGGTGGACGTCTTGGACCAGCCCCTTCACACCCTGCACCATATCCTCTCCCAGTTCCGGGCCTGTATCCAGCCTCAGCCCACGGCAGGGCCCAGGACCCGGGGCCGCCTCCACCATTGGCTGTACCGGCTCCAGGAGGCCCCAAAAAAGGAGTCCCCTGGCTGCCTCGAGGCCTCTGTCACCTTCAACCTCTTCCGCCTCCTCACGCGAGACCTGAATTGTGTTGCCAGTGGGGACCTGTGTGTCTGA

Length: 603

View AllClose