SEC23IP Clone BC063800 pUC

(No reviews yet) Write a Review
SKU:
CSB-CL896767HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
SEC23IP
Gene ID:
11196
Accession #:
BC063800
Vector:
pUC
€1,029.00
Frequently bought together:

Description

SEC23IP Clone BC063800 pUC | Cusabio

Gene Name: SEC23IP

Gene ID: 11196

Accession Number: BC063800

Plasmid: pUC

Sequence: ATGGCCGAGAGAAAACCTAACGGTGGCAGCGGCGGCGCCTCCACTTCCTCATCGGGCACTAACTTACTTTTCTCCTCCTCGGCCACGGAGTTCAGCTTCAATGTGCCCTTCATCCCAGTCACCCAGGCCTCCGCTTCTCCGGCCTCCCTGCTCTTACCGGGAGAGGATTCCACAGATGTTGGTGAGGAGGACAGCTTCCTTGGTCAGACTTCTATTCACACATCTGCCCCACAGACATTTAGTTACTTCTCTCAGGTATCAAGCAGCAGTGATCCTTTTGGGAATATTGGACAGTCACCATTAACAACTGCAGCAACCTCAGTTGGACAATCAGGATTCCCCAAGCCCCTGACTGCTCTCCCTTTTACAACTGGATCCCAAGATGTCTCGAATGCATTTTCACCATCCATTTCGAAGGCTCAACCTGGTGCTCCACCTTCCTCACTGATGGGAATAAATTCTTATCTGCCTTCTCAGCCAAGTAGTCTCCCTCCTTCATATTTTGGGAACCAACCCCAAGGAATTCCCCAACCAGGATACAATCCATATCGCCATACCCCTGGCAGCAGCAGGGCTAATCCTTACATTGCACCACCCCAGCTGCAGCAGTGCCAAACACCAGGCCCTCCTGCTCATCCTCCACCTTCTGGACCCCCTGTTCAGATGTACCAGATGCCTCCAGGATCTTTGCCACCGGTTCCTTCTTCAGTGCAGTCACCGGCACAGCAGCAGGTACCTGCCAGACCTGGGGCTCCCTCTGTTCAAGTGCCATCTCCTTTTCTACTTCAAAACCAATATGAGCCTGTTCAGCCCCACTGGTTTTACTGCAAGGAGGTAGAATACAAACAACTGTGGATGCCTTTTAGTGTGTTCGACTCTTTGAATCTTGAAGAAATCTATAATTCAGTTCAGCCAGATCCGGAGAGCGTGGTTCTTGGCACGGATGGAGGGCGCTACGATGTTTACCTCTATGACCGAATAAGGAAGGCTGCCTACTGGGAAGAGGAGCCAGCCGAAGTGAGACGCTGTACTTGGTTTTACAAGGGGGACACAGATAGTCGATTTATTCCCTATACTGAGGAGTTCAGTGAAAAACTAGAGGCTGAATATAAAAAAGCTGTAACCACTAATCAGTGGCACCGAAGATTAGAGTTTCCAAGTGGAGAGACAATTGTTATGCACAATCCAAAGGTTATTGTTCAGTTCCAGCCCTCCTCAGTGCCAGATGAATGGGGCACCACGCAAGATGGACAGACAAGGCCCAGGGTTGTAAAGCGTGGAATTGATGATAACCTTGATGAAATTCCCGACGGGGAGATGCCTCAAGTTGACCATTTGGTGTTTGTGGTGCATGGCATTGGACCTGTGTGTGACTTACGCTTTAGGAGCATTATTGAGTGTGTGGATGATTTTAGGGTGGTTTCTCTCAAATTGCTGCGGACACATTTCAAGAAATCTTTAGATGACGGGAAAGTAAGCAGAGTGGAGTTCCTTCCAGTTCATTGGCATAGTTCTTTGGGTGGGGACGCCACAGGTGTGGACAGGAATATTAAGAAAATCACTTTGCCAAGTATTGGTCGATTTCGTCACTTTACCAATGAAACTTTGCTAGATATTTTATTTTATAACAGCCCCACCTACTGTCAGACAATTGTGGAAAAAGTAGGAATGGAGATAAACCATCTGCATGCACTCTTTATGAGTCGGAACCCAGACTTCAAAGGAGGTGTCTCTGTTGCTGGTCACAGTTTAGGTTCTTTAATATTGTTTGACATCCTGTCTAATCAAAAAGATTTGAATTTATCAAAGTGCCCTGGACCTCTTGCTGTTGCTAATGGAGTTGTGAAGCAGCTACATTTTCAGGAAAAGCAGATGCCTGAAGAGCCAAAGCTGACTTTGGATGAGTCGTATGACCTTGTTGTTGAAAATAAAGAAGTCCTAACTTTGCAAGAAACTCTGGAAGCACTTAGCCTCTCTGAATATTTTAGCACTTTTGAAAAGGAAAAGATTGATATGGAGTCCCTGCTTATGTGTACAGTTGATGACCTGAAGGAAATGGGGATACCCCTTGGACCCAGAAAGAAGATAGCTAACTTTGTAGAACATAAAGCAGCCAAACTGAAAAAAGCAGCGTCAGAAAAGAAGGCAGTGGCGGCCACTTCTACAAAAGGACAAGAGCAAAGTGCCCAGAAGACTAAAGACATGGCTTCCCTCCCCTCAGAATCCAATGAGCCAAAGAGGAAACTTCCAGTTGGTGCTTGCGTGTCTTCTGTGTGTGTGAATTATGAATCTTTTGAAGTTGGCGCCGGACAGGTTTCTGTTGCTTACAACTCATTAGATTTTGAACCAGAGATATTCTTTGCCTTGGGGTCTCCAATTGCTATGTTTCTCACTATTCGAGGAGTTGATAGGATAGATGAGAATTACAGCCTTCCTACCTGTAAAGGGTTCTTCAATATTTATCATCCGCTTGATCCAGTGGCATATAGATTAGAACCTATGATTGTTCCAGATTTGGACCTAAAAGCTGTTCTCATTCCACATCACAAAGGCAGAAAAAGACTTCATTTAGAATTGAAAGAGAGTCTCTCTCGTATGGGATCTGATTTGAAGCAGGGTTTTATTAGCTCTCTCAAAAGTGCTTGGCAGACATTAAATGAGTTTGCCCGTGCTCATACGTCTTCAACCCAGTTGCAAGAAGAATTGGAGAAGGTGGCCAATCAGATCAAAGAAGAAGAAGAAAAGCAAGTAGTTGAAGCAGAAAAGGTTGTTGAAAGTCCAGATTTTTCCAAGGATGAGGACTACTTAGGAAAGGTTGGAATGTTAAATGGAGGCCGCCGAATTGACTACGTTCTCCAAGAAAAACCAATAGAGAGTTTTAATGAATACCTTTTCGCTCTTCAGAGTCACTTATGCTATTGGGAATCTGAAGATACTGCTCTGTTACTACTTAAAGAAATTTATCGAACAATGAACATTAGTCCAGAACAGCCCCAGCATTGA

Length: 3003

View AllClose