SEC24B Clone BC117135 pUC

(No reviews yet) Write a Review
SKU:
CSB-CL020951HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
SEC24B
Gene ID:
10427
Accession #:
BC117135
Vector:
pUC
€1,210.00
Frequently bought together:

Description

SEC24B Clone BC117135 pUC | Cusabio

Gene Name: SEC24B

Gene ID: 10427

Accession Number: BC117135

Plasmid: pUC

Sequence: ATGTCGGCCCCCGCCGGGTCCTCTCACCCGGCCGCCAGCGCCCGGATCCCGCCCAAGTTCGGCGGAGCGGCCGTCTCAGGAGCCGCAGCGCCCGCGGGCCCGGGTGCGGGCCCGGCGCCGCACCAGCAGAACGGTCCAGCCCAGAATCAAATGCAGGTTCCATCTGGATATGGATTGCATCATCAAAACTATATTGCTCCCTCAGGACATTACTCTCAAGGACCTGGGAAAATGACCTCATTGCCATTGGATACCCAGTGTGGTGATTACTACTCTGCTCTCTATACAGTACCAACACAAAATGTGACTCCTAACACAGTGAACCAGCAACCAGGAGCACAGCAGTTGTACAGCAGGGGTCCTCCTGCCCCTCATATTGTGGGATCCACTCTAGGATCTTTCCAAGGTGCTGCATCGTCAGCATCCCATTTGCATACGAGTGCCTCCCAACCATACTCCTCTTTTGTGAATCACTACAATAGTCCAGCCATGTACTCTGCCAGCTCTTCTGTTGCGTCTCAGGGATTTCCCTCTACTTGTGGTCATTATGCTATGTCAACTGTTTCTAATGCCGCGTATCCTAGTGTTTCATATCCCTCTCTGCCTGCTGGTGATACATATGGGCAAATGTTTACCTCACAGAATGCTCCGACTGTTAGGCCAGTTAAAGATAATTCATTCTCTGGTCAAAATACAGCTATCAGCCATCCATCGCCACTTCCACCTCTACCATCACAACAGCACCACCAGCAGCAAAGTCTTTCAGGATACAGTACTCTAACGTGGTCATCTCCAGGCCTTCCATCGACTCAAGACAATCTCATCCGAAACCACACAGGATCCCTGGCTGTAGCGAACAACAACCCAACCATTACTGTTGCAGATTCTTTATCCTGTCCTGTTATGCAAAATGTTCAGCCTCCCAAGTCCAGCCCAGTGGTATCCACTGTTTTATCAGGATCCTCAGGATCCTCATCAACAAGAACACCTCCCACTGCAAATCACCCAGTTGAGCCTGTGACCTCAGTTACACAGCCATCAGAGCTATTACAACAAAAAGGTGTTGACAGCTCTTCTACCACAAGCAGTGCTTCTCCAATGCCCAACAGTTATGATGCCCTGGAAGGAGGCAGTTACCCAGATATGCTTTCTTCATCAGCAAGCAGTCCTGCTCCTGATCCCGCCCCTGAACCTGATCCTGCTTCTGCTCCAGCTCCAGCTTCAGCTCCAGCTCCTGTCGTCCCTCAGCCTTCAAAAATGGCTAAGCCTTTTGGCTATGGCTATCCAACACTTCAGCCTGGTTATCAGAATGCTACAGCACCACTTATTTCTGGAGTACAGCCCAGTAACCCGGTATATTCTGGATTCCAGCAGTATCCTCAACAGTATCCTGGTGTGAACCAGCTATCCTCCAGTATAGGAGGATTGAGTCTTCAGAGTTCTCCACAACCAGAAAGCCTGAGACCTGTAAACCTTACTCAGGAGAGGAATATTTTACCTATGACTCCTGTTTGGGCTCCTGTACCTAACTTGAATGCAGACCTCAAAAAATTAAACTGTAGCCCAGATTCATTTCGGTGTACTTTGACAAATATTCCACAGACACAGGCTTTACTGAATAAAGCTAAGCTTCCTTTAGGATTGTTGTTACATCCCTTCAGAGACCTAACGCAATTACCAGTGATAACATCAAATACCATTGTGAGGTGCCGATCCTGTCGAACGTATATTAACCCCTTTGTATCCTTCATTGATCAACGTAGATGGAAATGCAATTTGTGCTATAGAGTAAACGATGTTCCTGAAGAATTTATGTATAACCCCCTTACCCGATCTTATGGAGAGCCTCATAAACGACCAGAAGTTCAGAATTCAACTGTGGAGTTCATTGCTTCTTCAGATTACATGCTGCGTCCTCCTCAACCTGCAGTTTACTTGTTTGTTTTAGATGTGTCTCATAATGCAGTGGAAGCTGGATATTTGACAATTTTGTGCCAGTCACTCCTAGAAAATCTAGACAAGCTTCCTGGAGATTCACGAACAAGAATAGGATTCATGACCTTTGATAGCACTATTCATTTCTACAATTTACAAGAAGGATTATCACAGCCTCAAATGTTGATTGTGTCTGATATAGATGATGTTTTTCTACCTACACCGGATAGTTTACTTGTGAATCTATATGAAAGTAAAGAGCTTATAAAAGACTTACTGAATGCATTACCAAACATGTTCACCAATACAAGAGAAACACACAGTGCCCTTGGTCCTGCACTTCAGGCTGCCTTTAAATTAATGTCTCCAACAGGTGGCCGTGTGTCTGTATTTCAGACACAGTTACCTTCCTTGGGTGCAGGACTTCTGCAATCCAGAGAAGATCCTAATCAGAGATCAAGTACAAAGGTGGTACAACATCTTGGCCCTGCAACTGATTTTTATAAGAAACTTGCATTAGATTGCTCGGGACAGCAAACTGCAGTGGATTTGTTCCTTTTAAGTTCACAGTATTCTGATCTTGCTTCTCTAGCTTGCATGTCCAAGTATTCTGCAGGGTGCATCTATTATTATCCATCATTCCACTATACTCACAATCCTTCACAAGCAGAAAAGTTACAAAAAGACCTAAAACGGTATCTCACAAGAAAAATTGGGTTTGAAGCTGTTATGAGAATAAGGTGTACTAAAGGTCTTTCAATGCACACTTTTCACGGTAACTTCTTTGTCCGTTCTACTGATTTGTTATCCCTTGCCAACATCAATCCTGATGCTGGATTTGCGGTGCAGTTGTCAATTGAAGAAAGTTTAACAGATACTTCCTTAGTATGTTTTCAAACAGCCCTATTATATACATCAAGCAAAGGTGAGCGGAGAATTAGAGTACATACACTTTGTTTGCCAGTGGTAAGTTCACTAGCAGATGTATATGCGGGAGTGGATGTACAAGCTGCCATCTGCCTTCTGGCAAACATGGCTGTGGATCGGTCCGTTTCATCAAGTCTGTCAGATGCAAGAGATGCCTTAGTGAATGCTGTAGTGGACTCATTGTCTGCATATGGCTCAACTGTCTCAAATTTACAGCACTCTGCATTGATGGCGCCCAGCTCCCTCAAGTTGTTTCCTCTCTATGTTTTGGCCCTTCTCAAACAGAAAGCATTTAGAACGGGTACAAGCACACGGCTGGATGATCGTGTATATGCCATGTGTCAGATAAAGTCTCAGCCACTTGTTCATCTAATGAAAATGATTCATCCCAACTTATACAGGATAGACAGATTGACAGATGAGGGTGCAGTACATGTTAATGACAGGATTGTACCACAGCCACCTCTTCAAAAATTGTCTGCAGAGAAGCTGACAAGAGAAGGTGCTTTCCTTATGGACTGTGGCTCTGTTTTTTACATTTGGGTTGGGAAAGGCTGTGACAATAACTTCATAGAGGATGTGCTTGGATATACTAATTTTGCATCAATACCACAGAAAATGACACATCTTCCAGAGCTAGATACACTTTCATCAGAAAGAGCCAGATCCTTCATAACTTGGCTTAGAGACAGCAGACCATTAAGTCCAATCCTTCACATAGTAAAAGATGAGAGTCCTGCCAAAGCAGAATTTTTTCAGCATTTGATTGAAGACCGGACAGAGGCTGCATTTTCTTACTATGAATTTTTGCTTCATGTTCAGCAGCAGATTTGTAAGTGA

Length: 3702

View AllClose