null

SEC31B Clone BC044569 pUC

(No reviews yet) Write a Review
SKU:
CSB-CL868291HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
SEC31B
Gene ID:
25956
Accession #:
BC044569
Vector:
pUC
€371.00
Frequently bought together:

Description

SEC31B Clone BC044569 pUC | Cusabio

Gene Name: SEC31B

Gene ID: 25956

Accession Number: BC044569

Plasmid: pUC

Sequence: ATGAAGCTGAAGGAACTTGAGCGGCCAGCTGTCCAGGCATGGAGCCCAGCCAGCCAATACCCTTTGTATCTGGCCACAGGAACATCTGCCCAACAGCTAGATTCCTCCTTCAGCACAAATGGCACATTGGAAATATTTGAGGTTGATTTCAGGGACCCTTCTCTGGACTTGAAACACAGAGGAGTCCTTTCTGCCTTGAGCAGGTTTCACAAGCTGGTCTGGGGGAGCTTTGGCAGTGGGCTTCTGGAAAGCTCCGGGGTTATTGCTGGCGGCGGGGACAATGGCATGCTTATTCTATACAATGTGACCCACATCCTGTCTTCGGGGAAGGAGCCTGTGATTGCTCAGAAACAGAAGCACACGGGGGCTGTCAGAGCCCTCGACTTTAATCCTTTCCAGGGCAACCTCCTGGCTTCAGGGGCCAGCGATTCTGAAATCTTCATTTGGGATCTGAATAACTTGAATGTGCCAATGACCCTGGGATCCAAGTCACAGCCTCCAGAGGACATCAAGGCACTGTCTTGGAACCGGCAAGCCCAACACATTCTGTCTTCTGCTCACCCCAGTGGCAAGGCAGTTGTGTGGGATCTCAGGAAGAATGAACCTATCATCAAAGTCAGTGATCACAGCAACAGGATGCACTGCTCAGGCCTGGCCTGGCATCCTGACATAGCCACCCAGTTAGTGCTGTGCTCAGAGGATGATCGACTTCCCGTGATTCAGCTGTGGGACTTGCGCTTTGCCTCCTCGCCCTTGAAGGTGCTGGAGAGCCACAGCAGGGGGATCTTGTCAGTGTCATGGAGCCAGGCTGATGCTGAGCTGCTGCTCACTAGTGCTAAGGACAGCCAGATCTTGTGCCGGAACCTGGGGAGCAGTGAGGTGGTATATAAGCTACCAACACAGAGCAGCTGGTGCTTTGATGTGCAGTGGTGCCCTCGGGACCCTTCAGTGTTCTCTGCTGCCTCCTTCAACGGCTGGATCAGTTTGTACGCTGTGATGGGTAGGAGCTGGGAAGTCCAGCACATGAGACAGGCTGACAAGGTTTGA

Length: 1047

View AllClose