null

SEMA3A Clone BC111416 pUC

(No reviews yet) Write a Review
SKU:
CSB-CL613506HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
SEMA3A
Gene ID:
10371
Accession #:
BC111416
Vector:
pUC
€701.00
Frequently bought together:

Description

SEMA3A Clone BC111416 pUC | Cusabio

Gene Name: SEMA3A

Gene ID: 10371

Accession Number: BC111416

Plasmid: pUC

Sequence: ATGGGCTGGTTAACTAGGATTGTCTGTCTTTTCTGGGGAGTATTACTTACAGCAAGAGCAAACTATCAGAATGGGAAGAACAATGTGCCAAGGCTGAAATTATCCTACAAAGAAATGTTGGAATCCAACAATGTGATCACTTTCAATGGCTTGGCCAACAGCTCCAGTTATCATACCTTCCTTTTGGATGAGGAACGGAGTAGGCTGTATGTTGGAGCAAAGGATCACATATTTTCATTCGACCTGGTTAATATCAAGGATTTTCAAAAGATTGTGTGGCCAGTATCTTACACCAGAAGAGATGAATGCAAGTGGGCTGGAAAAGACATCCTGAAAGAATGTGCTAATTTCATCAAGGTACTTAAGGCATATAATCAGACTCACTTGTACGCCTGTGGAACGGGGGCTTTTCATCCAATTTGCACCTACATTGAAATTGGACATCATCCTGAGGACAATATTTTTAAGCTGGAGAACTCACATTTTGAAAACGGCCGTGGGAAGAGTCCATATGACCCTAAGCTGCTGACAGCATCCCTTTTAATAGATGGAGAATTATACTCTGGAACTGCAGCTGATTTTATGGGGCGAGACTTTGCTATCTTCCGAACTCTTGGGCACCACCACCCAATCAGGACAGAGCAGCATGATTCCAGGTGGCTCAATGATCCAAAGTTCATTAGTGCCCACCTCATCTCAGAGAGTGACAATCCTGAAGATGACAAAGTATACTTTTTCTTCCGTGAAAATGCAATAGATGGAGAACACTCTGGAAAAGCTACTCACGCTAGAATAGGTCAGATATGCAAGAATGACTTTGGAGGGCACAGAAGTCTGGTGAATAAATGGACAACATTCCTCAAAGCTCGTCTGATTTGCTCAGTGCCAGGTCCAAATGGCATTGACACTCATTTTGATGAACTGCAGGATGTATTCCTAATGAACTTTAAAGATCCTAAAAATCCAGTTGTATATGGAGTGTTTACGACTTCCAGTAACATTTTCAAGGGATCAGCCGTGTGTATGTATAGCATGAGTGATGTGAGAAGGGTGTTCCTTGGTCCATATGCCCACAGGGATGGACCCAACTATCAATGGGTGCCTTATCAAGGAAGAGTCCCCTATCCACGGCCAGGAACTTGTCCCAGCAAAACATTTGGTGGTTTTGACTCTACAAAGGACCTTCCTGATGATGTTATAACCTTTGCAAGAAGTCATCCAGCCATGTACAATCCAGTGTTTCCTATGAACAATCGCCCAATAGTGATCAAAACGGATGTAAATTATCAATTTACACAAATTGTCGTAGACCGAGTGGATGCAGAAGATGGACAGTATGATGTTATGTTTATCGGAACAGATGTTGGGACCGTTCTTAAAGTAGTTTCAATTCCTAAGGAGACTTGGTATGATTTAGAAGAGGTTCTGCTGGAAGAAATGACAGTTTTTCGGGAACCGACTGCTATTTCAGCAATGGAGCTTTCCACTAAGCAGCAACAACTATATATTGGTTCAACGGCTGGGGTTGCCCAGCTCCCTTTACACCGGTGTGATATTTACGGGAAAGCGTGTGCTGAGTGTTGCCTCGCCCGAGACCCTTACTGTGCTTGGGATGGTTCTGCATGTTCTCGCTATTTTCCCACTGCAAAGAGACGCACAAGACGACAAGATATAAGAAATGGAGACCCACTGACTCACTGTTCAGACTTACACCATGATAATCACCATGGCCACAGCCCTGAAGAGAGAATCATCTATGGTGTAGAGAATAGTAGCACATTTTTGGAATGCAGTCCGAAGTCGCAGAGAGCGCTGGTCTATTGGCAATTCCAGAGGCGAAATGAAGAGCGAAAAGAAGAGATCAGAGTGGATGATCATATCATCAGGACAGATCAAGGCCTTCTGCTACGTAGTCTACAACAGAAGGATTCAGGCAATTACCTCTGCCATGCGGTGGAACATGGGTTCATACAAACTCTTCTTAAGGTAACCCTGGAAGTCATTGACACAGAGCATTTGGAAGAACTTCTTCATAAAGATGATGATGGAGATGGCTCTAAGACCAAAGAAATGTCCAATAGCATGACACCTAGCCAGAAGGTCTGGTACAGAGACTTCATGCAGCTCATCAACCACCCCAATCTCAACACGATGGATGAGTTCTGTGAACAAGTTTGGAAAAGGGACCGAAAACAACGTCGGCAAAGGCCAGGACATACCCCAGGGAACAGTAACAAATGGAAGCACTTACAAGAAAATAAGAAAGGTAGAAACAGGAGGACCCACGAATTTGAGAGGGCACCCAGGAGTGTCTGA

Length: 2316

View AllClose