null

SETDB1 Clone BC028671 pUC

(No reviews yet) Write a Review
SKU:
CSB-CL619960HU2
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
SETDB1
Gene ID:
9869
Accession #:
BC028671
Vector:
pUC
€1,298.00
Frequently bought together:

Description

SETDB1 Clone BC028671 pUC | Cusabio

Gene Name: SETDB1

Gene ID: 9869

Accession Number: BC028671

Plasmid: pUC

Sequence: ATGTCTTCCCTTCCTGGGTGCATTGGTTTGGATGCAGCAACAGCTACAGTGGAGTCTGAAGAGATTGCAGAGCTGCAACAGGCAGTGGTTGAGGAACTGGGTATCTCTATGGAGGAACTTCGGCATTTCATCGATGAGGAACTGGAGAAGATGGATTGTGTACAGCAACGCAAGAAGCAGCTAGCAGAGTTAGAGACATGGGTAATACAGAAAGAATCTGAGGTGGCTCACGTTGACCAACTCTTTGATGATGCATCCAGGGCAGTGACTAATTGTGAGTCTTTGGTGAAGGACTTCTACTCCAAGCTGGGACTACAATACCGGGACAGTAGCTCTGAGGACGAATCTTCCCGGCCTACAGAAATAATTGAGATTCCTGATGAAGATGATGATGTCCTCAGTATTGATTCAGGTGATGCTGGGAGCAGAACTCCAAAAGACCAGAAGCTCCGTGAAGCTATGGCTGCCTTAAGAAAGTCAGCTCAAGATGTTCAGAAGTTCATGGATGCTGTCAACAAGAAGAGCAGTTCCCAGGATCTGCATAAAGGAACCTTGAGTCAGATGTCTGGAGAACTAAGCAAAGATGGTGACCTGATAGTCAGCATGCGAATTCTGGGCAAGAAGAGAACTAAGACTTGGCACAAAGGCACCCTTATTGCCATCCAGACAGTTGGGCCAGGGAAGAAATACAAGGTGAAATTTGACAACAAAGGAAAGAGTCTACTGTCGGGGAACCATATTGCCTATGATTACCACCCTCCTGCTGACAAGCTGTATGTGGGCAGTCGGGTGGTCGCCAAATACAAAGATGGGAATCAGGTCTGGCTCTATGCTGGCATTGTAGCTGAGACACCAAACGTCAAAAACAAGCTCAGGTTTCTCATTTTCTTTGATGATGGCTATGCTTCCTATGTCACACAGTCGGAACTGTATCCCATTTGCCGGCCACTGAAAAAGACTTGGGAGGACATAGAAGACATCTCCTGCCGTGACTTCATAGAGGAGTATGTCACTGCCTACCCCAACCGCCCCATGGTACTGCTCAAGAGTGGCCAGCTTATCAAGACTGAGTGGGAAGGCACGTGGTGGAAGTCCCGAGTTGAGGAGGTGGATGGCAGCCTAGTCAGGATCCTCTTCCTGGATGACAAAAGATGTGAGTGGATCTATCGAGGCTCTACACGGCTGGAGCCCATGTTCAGCATGAAAACATCCTCAGCCTCTGCACTGGAGAAGAAGCAAGGACAGCTCAGGACACGTCCAAATATGGGTGCTGTGAGGAGCAAAGGCCCTGTTGTCCAGTACACACAGGATCTGACCGGTACTGGAACCCAGTTCAAGCCAGTGGAACCCCCACAGCCTACAGCTCCACCTGCCCCACCTTTCCCACCTGCTCCACCTCTATCCCCCCAAGCAGGTGACAGTGACTTGGAAAGCCAGCTTGCCCAGTCACGGAAGCAGGTAGCCAAAAAGAGCACGTCCTTTCGACCAGGATCTGTGGGCTCTGGTCATTCCTCCTCTACATCTCCTGCACTCAGTGAAAATGTCTCTGGTGGGAAACCTGGGATCAACCAGACATATAGATCACCTTTAGGCTCCACAGCCTCTGCCCCAGCACCCTCAGCACTCCCGGCCCCTCCAGCACCCCCAGTCTTCCATGGCATGCTGGAGCGGGCCCCAGCAGAGCCCTCCTACCGTGCTCCCATGGAGAAGCTTTTCTACTTACCTCATGTCTGCAGCTATACCTGCCTGTCTCGAGTCAGACCTATGAGGAATGAGCAGTACCGGGGCAAGAACCCTCTGCTGGTCCCGTTACTATATGACTTCCGGCGGATGACAGCCCGGCGTCGAGTTAACCGCAAGATGGGCTTTCATGTTATCTATAAGACACCTTGTGGTCTCTGCCTTCGGACAATGCAGGAGATAGAACGCTACCTTTTCGAGACTGGCTGTGACTTCCTCTTCCTGGAGATGTTCTGTTTGGATCCATATGTTCTTGTGGACCGAAAGTTTCAGCCCTATAAGCCTTTTTACTATATTTTGGACATCACTTATGGGAAGGAAGATGTTCCCCTATCCTGTGTCAATGAGATTGACACAACCCCTCCACCCCAGGTGGCCTACAGCAAGGAACGTATCCCGGGCAAGGGTGTTTTCATTAACACAGGCCCTGAATTTCTGGTTGGCTGTGACTGCAAGGATGGGTGTCGGGACAAGTCCAAGTGTGCCTGCCATCAACTAACTATCCAGGCTACAGCCTGTACCCCAGGAGGCCAAATCAACCCTAACTCTGGCTACCAGTACAAGAGACTAGAAGAGTGTCTACCCACAGGGGTATATGAGTGTAACAAACGCTGCAAATGTGACCCAAACATGTGCACAAACCGGTTGGTGCAACATGGACTACAAGTTCGGCTACAGCTATTCAAGACACAGAACAAGGGCTGGGGTATCCGCTGCTTGGATGACATTGCCAAAGGCTCTTTTGTTTGTATTTATGCAGGCAAAATCCTGACAGATGACTTTGCAGACAAGGAGGGTCTGGAAATGGGTGATGAGTACTTTGCAAATCTGGACCATATCGAGAGCGTGGAGAACTTCAAAGAAGGATATGAGAGTGATGCCCCCTGTTCCTCTGACAGCAGTGGTGTAGACTTGAAGGACCAGGAAGATGGCAACAGCGGTACAGAGGACCCTGAAGAGTCCAATGATGATAGCTCAGATGATAACTTCTGTAAGGATGAGGACTTCAGCACCAGTTCAGTGTGGCGGAGCTATGCTACCCGGAGGCAGACCCGGGGCCAGAAAGAGAACGGACTCTCTGAGACAACTTCCAAGGACTCCCACCCCCCAGATCTTGGACCCCCACATATTCCTGTTCCTCCCTCAATCCCTGTAGGTGGCTGCAATCCACCTTCCTCCGAAGAGACACCCAAGAACAAGGTGGCCTCATGGTTGAGCTGCAATAGTGTCAGTGAAGGTGGTTTTGCTGACTCTGATAGCCATTCATCCTTCAAGACTAATGAAGGTGGGGAGGGCCGGGCTGGGGGAAGCCGAATGGAGGCTGAGAAGGCCTCCACCTCAGGACTAGGCATCAAGGATGAGGGAGACATCAAACAGGCCAAGAAAGAGGACACTGACGACCGAAACAAGATGTCAGTAGTTACTGAAAGCTCTCGAAATTACGGTTACAATCCTTCTCCTGTGAAGCCTGAAGGACTTCGCCGCCCACCTAGTAAGACTAGTATGCATCAAAGCCGAAGACTCATGGCTTCTGCTCAGTCCAACCCTGATGATGTCCTGACACTGTCCAGCAGCACAGAAAGTGAGGGGGAAAGTGGGACCAGCCGAAAGCCCACTGCTGGTCAGACTTCGGCTACAGCGGTTGACAGTGATGATATCCAGACCATATCCTCTGGCTCTGAAGGGGATGACTTTGAGGACAAGAAGAACATGACTGGTCCAATGAAGCGTCAAGTGGCAGTAAAATCAACCCGAGGCTTTGCTCTTAAATCAACCCATGGGATTGCAATTAAATCAACCAACATGGCCTCTGTGGACAAGGGGGAGAGCGCACCTGTTCGTAAGAACACACGCCAATTCTATGATGGCGAGGAGTCTTGCTACATCATTGATGCCAAGCTTGAAGGCAACCTGGGCCGCTACCTCAACCACAGTTGCAGCCCCAACCTGTTTGTCCAGAATGTCTTCGTGGATACCCATGATCTTCGCTTCCCCTGGGTGGCCTTCTTTGCCAGCAAAATCCGGGCTGGGACAGAACTTACTTGGGACTACAACTACGAGGTGGGCAGTGTGGAAGGCAAGGAGCTACTCTGTTGCTGTGGGGCCATTGAATGCAGAGGACGTCTTCTTTAG

Length: 3873

View AllClose