null

SF3A1 Clone BC001976 pUC

(No reviews yet) Write a Review
SKU:
CSB-CL613594HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
SF3A1
Gene ID:
10291
Accession #:
BC001976
Vector:
pUC
€718.00
Frequently bought together:

Description

SF3A1 Clone BC001976 pUC | Cusabio

Gene Name: SF3A1

Gene ID: 10291

Accession Number: BC001976

Plasmid: pUC

Sequence: ATGCCGGCCGGACCCGTGCAGGCGGTGCCCCCGCCGCCGCCCGTGCCCACGGAGCCCAAACAGCCCACAGAAGAAGAAGCATCTTCAAAGGAGGATTCTGCACCTTCTAAGCCAGTTGTGGGGATTATTTACCCTCCTCCAGAGGTCAGAAATATTGTTGACAAGACTGCCAGCTTTGTGGCCAGAAACGGGCCTGAATTTGAAGCTAGGATCCGACAGAACGAGATCAACAACCCCAAGTTCAACTTTCTGAACCCCAATGACCCTTACCATGCCTACTACCGCCACAAGGTCAGCGAGTTCAAGGAAGGGAAGGCTCAGGAGCCGTCCGCCGCCATCCCCAAGGTCATGCAGCAGCAGCAGCAGACCACCCAGCAGCAGCTGCCCCAGAAGGTCCAAGCCCAAGTAATCCAAGAGACCATCGTGCCCAAAGAGCCTCCTCCTGAGTTTGAGTTCATTGCTGATCCTCCCTCTATCTCAGCCTTCGACTTGGATGTGGTGAAGCTGACGGCTCAGTTTGTGGCCAGGAATGGGCGCCAGTTTCTGACCCAGCTGATGCAGAAAGAGCAGCGCAACTACCAGTTTGACTTTCTCCGCCCACAGCACAGCCTCTTCAACTACTTCACGAAGCTAGTGGAACAGTACACCAAGATCTTGATTCCACCCAAAGGTTTATTTTCAAAGCTCAAGAAAGAGGCTGAAAACCCCCGAGAAGTTTTGGATCAGGTGTGTTACCGAGTGGAATGGGCCAAATTCCAGGAACGTGAGAGGAAGAAGGAAGAAGAGGAGAAGGAGAAGGAGCGGGTGGCCTATGCTCAGATCGACTGGCATGATTTTGTGGTGGTGGAAACAGTGGACTTCCAACCCAATGAGCAAGGGAACTTCCCTCCCCCCACCACGCCAGAGGAGCTGGGGGCCCGAATCCTCATTCAGGAGCGCTATGAAAAGTTTGGGGAGAGTGAGGAAGTTGAGATGGAGGTCGAGTCTGATGAGGAGGATGACAAACAGGAGAAGGCGGAGGAGCCTCCTTCCCAGCTGGACCAGGACACCCAAGTACAAGATATGGATGAGGGTTCAGATGATGAAGAAGAAGGGCAGAAAGTGCCCCCACCCCCAGAGACACCCATGCCTCCACCTCTGCCCCCAACTCCAGACCAAGTCATTGTCCGCAAGGATTATGATCCCAAAGCCTCCAAGCCCTTGCCTCCAGCCCCTGCTCCAGATGAGTATCTTGTGTCCCCCATTACTGGGGAGAAGATCCCCGCCAGCAAAATGCAGGAACACATGCGCATTGGACTTCTTGACCCTCGCTGGCTGGAGCAGCGGGATCGCTCCATCCGTGAGAAGCAGAGCGATGATGAGGTGTACGCACCAGGTCTGGATATTGAGAGCAGCTTGAAGCAGTTGGCTGAGCGGCGTACTGACATCTTCGGTGTAGAGGAAACAGCCATTGGTAAGAAGATCGGTGAGGAGGAGATCCAGAAGCCAGAGGAAAAGGTGACCTGGGATGGCCACTCAGGCAGCATGGCCCGGACCCAGCAGGCTGCCCAGGCCAACATCACCCTCCAGGAGCAGATTGAGGCCATTCACAAGGCCAAAGGCCTGGTGCCAGAGGATGACACTAAAGAGAAGATTGGCCCCAGCAAGCCCAATGAAATCCCTCAACAGCCACCGCCACCATCTTCAGCCACCAACATCCCCAGCTCGGCTCCACCCATCACTTCAGTGCCCCGACCACCCACAATGCCACCTCCAGTTCGTACTACAGTTGTCTCCGCAGTACCCGTCATGCCCCGGCCCCCAATGGCATCTGTGGTCCGGCTGCCCCCAGGCTCAGTGATCGCCCCCATGCCGCCCATCATCCACGCGCCCAGAATCAACGTGGTGCCCATGCCTCCCTCGGCCCCTCCTATTATGGCCCCCCGCCCACCCCCCATGATTGTGCCAACAGCCTTTGTGCCTGCTCCACCTGTGGCACCTGTCCCAGCTCCAGCCCCAATGCCCCCTGTGCATCCCCCACCTCCCATGGAAGATGAGCCCACCTCCAAAAAACTGAAGACAGAGGACAGCCTCATGCCAGAGGAGGAGTTCCTGCGCAGAAACAAGGGTCCAGTGTCCATCAAAGTCCAGGTGCCCAACATGCAGGATAAGACGGAATGGAAACTGAATGGGCAGGTGCTGGTCTTCACCCTCCCACTCACGGACCAGGTCTCTGTCATTAAGGTGAAGATTCATGAAGCCACAGGCATGCCTGCAGGGAAACAGAAGCTACAGTATGAGGGTATCTTCATCAAAGATTCCAACTCACTGGCTTACTACAACATGGCCAATGGCGCAGTCATCCACCTGGCCCTCAAGGAGAGAGGCGGGAGGAAGAAGTAG

Length: 2382

View AllClose