null

SFI1 Clone BC033613

(No reviews yet) Write a Review
SKU:
CSB-CL021132HU1
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
SFI1
Gene ID:
9814
Accession #:
BC033613
Vector:
pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

SFI1 Clone BC033613 | Cusabio

Gene Name: SFI1

Gene ID: 9814

Accession Number: BC033613

Plasmid: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCCCAGGCCCACCCCAGCTTACTTGCTGACCTTGGCCTCGCCTTTCCTGACTTTCAGTCTCCCTATAAAATTGGAGATCCCACAGAGATCTCAGACCCCCCTGCAGCCCCTGGTCAGCCCAGGGGAACAGACCCCATGTTTCTTTCCAGCAACACTGCCCACTCAGCGAGGAAGCAGCCGCGACGCCCACACTTCCTGTTGGAGCCTGCGCAGAGCCAGAGGCCTCAGAAGCCACAGGAACATGGCCTAGGCATGGCTCAGCCAGCAGCCCCCTCCCTGACGCGGCCCTTCCTGGCAGAGGCCCCGACAGCACTGGTCCCACACAGCCCCCTGCCTGGGGCCCTGTCAAGCGCCCCTGGCCCGAAGCAGCCCCCGACGGCAAGCACAGGCCCGGAGCTGCTGCTGCTGCCTCTTTCCTCCTTCATGCCCTGCGGGGCGGCTGCACCAGCCAGGGTGTCAGCACAGCGGGCTACTCCTAGGGATAAGCCCCCGGTCCCCTCATCCCTGGCCAGTGTCCCTGACCCCCATCTACTCCTTCCTGGGGACTTCTCAGCCACCAGGGCTGGGCCTGGACTTTCAACTGCAGGCAGCCTGGACCTTGAGGCTGAACTTGAGGAGATCCAGCAGCAACTACTGCACTACCAGACCACCAAGCAGAACCTCTGGTCCTGTCGGCGGCAAGCGAGCAGCCTGCGCAGGTGGCTGGAGCTGAACAGAGAGGAGCCGGGGCCTGAGGACCAGGAAGTAGAGCAGCAGGTGCAGAAAGAGCTGGAACAGGTGGAAATGCAGATCCAGCTGCTGGCAGAGGAGCTCCAGGCTCAGCGCCAGCCCATTGGCGCCTGCGTTGCCCGCATCCAGGCCCTGCGGCAGGCCCTGTGCTAG

Length: 885

View AllClose