null

SFMBT1 Clone BC014614 pUC

(No reviews yet) Write a Review
SKU:
CSB-CL883396HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
SFMBT1
Gene ID:
51460
Accession #:
BC014614
Vector:
pUC
€776.00
Frequently bought together:

Description

SFMBT1 Clone BC014614 pUC | Cusabio

Gene Name: SFMBT1

Gene ID: 51460

Accession Number: BC014614

Plasmid: pUC

Sequence: ATGAACGGGGAGCAGCAGCTTGATGCAGATGCCGGCTCTGGTATGGAAGAGGTAGAATTAAGCTGGGAAGATTATCTAGAAGAAACAGGGTCCACAGCAGTTCCCTATGGGTCTTTTAAACATGTGGACACACGTCTGCAAAATGGATTTGCTCCTGGGATGAAGCTGGAGGTGGCTGTGAGAACAGATCCTGAGACCTACTGGGTTGCCACCGTTATCACTACCTGTGAGCAGTTGCTCCTTCTCCGCTATGATGGCTATGGGGAGGATCGGAGAGCAGATTTCTGGTGTGACATCAGGAAGGCTGATCTCTACCCCATTGGGTGGTGTGAGCAGAATAAGAAGACCCTTGAAGCCCCAGAAGGCATCAGAGATAAAGTATCTGACTGGGATGAGTTTCTGCGGCAGACCCTGATAGGAGCATGTAGTCCTCCTGTTCCGCTGCTAGAGGGCCTCCGTAATGGGAGGAATCCTTTAGATCTCATTGCTCCAGGATCCAGACTAGAATGTCAAGCTTTCCAGGACTCTTTAAGCACTTGGATTGTTACTGTAGTAGAAAACATTGGAGGAAGGCTGAAGCTACGTTATGAAGGACTTGAAAGTTCTGACAATTATGAACATTGGTTGTATTACTTGGATCCATTTCTTCATCACGTTGGTTGGGCTGCTCAACAGGGATATGAGCTTCAGCCCCCTTCAGCCATTAGACATCTAAAAAATGAAGCTGAGTGGCAAGAGATTTTGGCCAAAGTGAAAGAGGAAGAGGAAGAGCCATTACCATCTTACTTATTTAAGGACAAACAAGTTATTGGCATTCATACATTCTCTGTAAACATGAAATTGGAAGCTGTAGACCCCTGGTCTCCTTTTGGGATCTCTCCTGCTACAGTTGTTAAGGTTTTTGATGAGAAGTACTTTCTGGTGGAAATGGATGACTTGCGTCCTGAGAACCACGCACGGCGATCCTTTGTGTGCCACGCCGACAGTCCTGGCATCTTCCCTGTGCAGTGGAGTCTGAAGAATGGCCTACACATCAGCCCCCCTCCAGGCTACCCAAGCCAGGACTTTGACTGGGCTGACTACCTCAAACAGTGTGGTGCTGAAGCTGCTCCCCAGAGGTGCTTCCCTCCGTTAATTTCTGAACATGAATTTAAGGAGAACATGAAGCTCGAGGCGGTGAACCCCATTCTCCCTGAAGAAGTGTGTGTTGCTACCATCACTGCAGTGAGAGGCTCCTACCTGTGGCTCCAGCTGGAGGGTTCTAAGAAGCCTATACCTGAATGTATTGTGAGTGTGGAATCCATGGATATATTTCCTTTGGGCTGGTGTGAAACCAACGGCCACCCCCTCAGCACTCCTCGCCGAGCACGAGTATATAAACAGAGGAAAATTGCAGTGGTTCAGCCAGAAAAACAAGTACCATCCTCGAGGACTGTCCACGAGGGCCTGAGGAATCAGGAGCTGAACTCCACAGAGTCAGTTATGATTAATGGAAAATATTGCTGTCCAAAGATATACTTCAACCACCGTTGCTTCTCAGGGCCATATCTTAACAAAGGAAGAATTGCTGAGCTGCCTCAATGTGTAGGACCTGGGAACTGTGTTCTGGTCCTTAGAGAGGTCCTCACTTTACTTATCAATGCAGCCTACAAACCCAGCCGTGTCCTTCGGGAGCTCCAGCTGGACAAAGACTCTGTGTGGCACGGATGTGGGGAAGTCCTAAAAGCCAAATATAAAGGAAAGAGTTATCGGGCTACTGTTGAGATAGTGAAAACAGCAGATCGGGTGACTGAATTCTGCCGGCAAACCTGTATCAAACTGGAATGCTGTCCTAACCTCTTCGGTCCACGGATGGTTCTGGATAAGTGTTCTGAGAACTGTTCTGTACTTACAAAGACCAAATACACACACTATTACGGAAAGAAGAAAAATAAAAGAATTGGGAGGCCACCTGGTGGGCATAGTAACTTAGCTTGTGCCCTGAAAAAAGCCAGTAAGAGGAGAAAGAGGCGGAAAAATGTTTTTGTTCATAAGAAGAAACGCTCCTCTGCATCTGTTGATAATACCCCAGCGGGCTCTCCCCAGGGAAGTGGGGGTGAAGATGAGGATGACCCAGATGAAGGGGATGATGATTCCCTAAGTGAAGGCAGTACATCCGAGCAGCAGGATGAGCTACAGGAAGAATCAGAAATGTCAGAAAAAAAGTCATGCTCCTCTTCTCCCACCCAAAGTGAGATATCCACATCGCTGCCTCCAGATAGACAAAGGAGAAAAAGGGAGCTTCGCACCTTTTCATTTTCTGACGATGAAAATAAACCTCCTTCACCAAAGGAAATAAGGATCGAAGTTGCTGAAAGGCTTCACCTGGACAGTAACCCCTTGAAGTGGAGTGTGGCAGACGTTGTGCGGTTCATCAGATCCACTGACTGTGCTCCATTAGCAAGAATATTCCTAGACCAGGAAATTGATGGGCAGGCCCTGTTGCTCCTTACCCTTCCCACTGTTCAAGAATGCATGGACTTAAAATTGGGCCCTGCCATCAAACTTTGCCATCACATAGAGAGGATCAAGTTTGCTTTTTATGAGCAGTTTGCCAACTGA

Length: 2601

View AllClose