SIRT6 Clone BC005026 pUC

(No reviews yet) Write a Review
SKU:
CSB-CL854057HU1
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
SIRT6
Gene ID:
51548
Accession #:
BC005026
Vector:
pUC
€378.00
Frequently bought together:

Description

SIRT6 Clone BC005026 pUC | Cusabio

Gene Name: SIRT6

Gene ID: 51548

Accession Number: BC005026

Plasmid: pUC

Sequence: ATGTCGGTGAATTACGCGGCGGGGCTGTCGCCGTACGCGGACAAGGGCAAGTGCGGCCTCCCGGAGATCTTCGACCCCCCGGAGGAGCTGGAGCGGAAGGTGTGGGAACTGGCGAGGCTGGTCTGGCAGTCTTCCAGTGTGGTGTTCCACACGGGTGCCGGCATCAGCACTGCCTCTGGCATCCCCGACTTCAGGGGTCCCCACGGAGTCTGGACCATGGAGGAGCGAGGTCTGGCCCCCAAGTTCGACACCACCTTTGAGAGCGCGCGGCCCACGCAGACCCACATGGCGCTGGTGCAGCTGGAGCGCGTGGGCCTCCTCCGCTTCCTGGTCAGCCAGAACGTGGACGGGCTCCATGTGCGCTCAGGCTTCCCCAGGGACAAACTGGCAGAGCTCCACGGGAACATGTTTGTGGAAGAATGTGCCAAGTGTAAGACGCAGTACGTCCGAGACACAGTCGTGGGCACCATGGGCCTGAAGGCCACGGGCCGGCTCTGCACCGTGGCTAAGGCAAGGGGGCTGCGAGCCTGCAGGGGAGAGCTGAGGGACACCATCCTAGACTGGGAGGACTCCCTGCCCGACCGGGACCTGGCACTCGCCGATGAGGCCAGCAGGAACGCCGACCTGTCCATCACGCTGGGTACATCGCTGCAGATCCGGCCCAGCGGGAACCTGCCGCTGGCTACCAAGCGCCGGGGAGGCCGCCTGGTCATCGTCAACCTGCAGCCCACCAAGCACGACCGCCATGCTGACCTCCGCATCCATGGCTACGTTGACGAGGTCATGACCCGGCTCATGAAGCACCTGGGGCTGGAGATCCCCGCCTGGGACGGCCCCCGTGTGCTGGAGAGGGCGCTGCCACCCCTGCCCCGCCCGCCCACCCCCAAGCTGGAGCCCAAGGAGGAATCTCCCACCCGGATCAACGGCTCTATCCCCGCCGGCCCCAAGCAGGAGCCCTGCGCCCAGCACAACGGCTCAGAGCCCGCCAGCCCCAAACGGGAGCGGCCCACCAGCCCTGCCCCCCACAGACCCCCCAAAAGGGTGAAGGCCAAGGCGGTCCCCAGCTGA

Length: 1068

View AllClose